Thermotolerance Acquisition in Native Chicken and its Crosses by Early Thermal Conditioning Through Expression of Heat Shock

Varun A1* , Omprakash A.V2 , Kumanan K2 , Vairamuthu S2 , Ezhilvalavan S2 , Karthikeyan N2 , Vijayarani K2 , Nithya Quintoil1

1Rajiv Gandhi Institute of Veterinary Education and Research, Puducherry – 09, India

2Tamil Nadu Veterinary and Animal Sciences University, Chennai – 51, India

Corresponding Author Email: varunsivagangai92@gmail.com

DOI : https://doi.org/10.5281/zenodo.8077830

Keywords

Heat Shock Protein, Native chicken, Thermal conditioning, Triiodothyronine

Download this article as:

Abstract

The present experiment was conducted to study the effect of thermal conditioning on liver HSPs mRNA expression and serum T3 levels in native chicken Aseel (ASL), Naked Neck (NN), and it’s cross variety Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) under heat stress. Chicks from four varieties (ASL, ARW, NN, NNB3) were divided into control (C) and heat-exposed (H) groups. The control chicks (C) were reared in at ambient temperature (28±1°C). H group chicks were heat stressed at 39±1º C for 2 hours daily during 0-2 weeks and 5-6 weeks of age. In 12th week, the control group (C) was divided into two groups i.e., unexposed control (C) and control exposed (CE). Birds from H (HE) group and the CE group were thermal challenged 39±1°C for 4 hours daily on the 12th week. On 14th, 42nd, and 84th day, serum was collected and processed for Triiodothyronine (T3) by Radioimmuno assay kit. The Cloacal temperature and T3 concentration were significantly (p<0.01) high and low in the H group, irrespective of varieties at 14th and 42nd d. On the 84th d birds from each group were sacrificed and liver samples were collected for further processing. On 84th day the relative mRNA expression (fold change) of all four HSP genes (HSP 20, 60, 70, and 90) were significantly (P<0.01) high in HE and CE groups in all four varieties. CE (suddenly exposed) group birds, not exposed to high temperature during early age had significantly (P<0.01) high mRNA expression, while pre-conditioned birds (HE) had significantly (P<0.05) low gene expression. From the present study, it can be concluded that the thermal conditioning of chicks during early age had a positive effect and improves the thermo tolerance in the later part as revealed by the low expression of the HSPs gene, temperature, and improved T3 levels as stress indicators in native chickens and its cross varieties.

Introduction

In the poultry industry, heat stress is one of the major causes for mortality with negative effects on the production and welfare of poultry[1]. Temperature is one of the critical factors that exerts a negative influence on the performance of poultry and causes huge losses in terms of loss of productivity, reduced growth rate, feed efficiency, egg shell quality, survivability, reduced reproductive efficiency, reduced immune competence and increased investment costs to mitigate the effects of temperature-induced climate change [2,3]. Temperature beyond the thermal neutral zone (18-24°C) due to climatic change and another factor that leads to cascading effects on thermoregulation and could be lethal to the birds as birds are more vulnerable to high temperature.

            Heat shock proteins (HSPs) were a set of proteins synthesized in response to physical, chemical, or biological stresses including heat exposure [4],which effectively protects several proteins and cell organelles from stressors. HSPs are broadly classified into six distinct families based on their molecular weights ranging from 10 to 150 kDa [5]. Changes in HSPs expression can be detected during heat stress in various vital organs viz, heart, liver, and kidneys can be correlated with thermal tolerance degree in living organisms.

            The genetic selection of birds for thermo tolerance is a big challenge in global poultry production. In tropical and sub-tropical countries, the ventilation systems in poultry houses are not fully functional due to high environmental humidity. In the present day, crossbreeding between indigenous breeds is one of the most popular breeding methods for obtaining a commercial hybrid resistant to tropical weather conditions with the potential of producing a reasonable amount of eggs and meat [6]. The genetic control of heat tolerance is complex and has low heritability. Few indigenous chickens and very few exotic breeds, have adequate heat tolerance [7]. The introgression of genes from thermo-tolerant strains into grand parental stock is an effective strategy applied to create the genetic progress of commercial strains that can tolerate heat stress. The genes associated with heat tolerance have been investigated in chickens, including the naked-neck, frizzle,, and dwarfism [8],and slow/rapid featheringgenes [9]. Aseel is one of the native chickens, which is hardy in nature and had considerable heat tolerance potential. Hence, the present study was conducted to evaluate the effects of thermal conditioning on liver HSP 90, 70, 60,, and 20 mRNA expression and serum T3 levels in native chicken Aseel (ASL), Naked Neck (NN) and its cross variety such as, Aseel x Nandanam chicken-4 (ARW), and Naked neck x Nandanam broiler-3 (NNB3), under heat-induced stress conditions.

Material and Methods

            The experiment was conducted at Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India. The experimental design and work were approved by the Institutional Animal Ethics Committee (IAEC; Approval No.30/SA/IAEC/2017). The native chicken Aseel (ASL), Naked neck (NN),, and the cross varieties were developed by introducing NN birds into the Nandanam broiler-3 (NNB3) and the Aseel birds into the Nandanam chicken-4 (ARW) population to observe the effect of thermal conditioning of chicks on the expression of HSP genes in liver tissue. Nandanam broiler-3 and Nandanam chicken-4 were synthetic broilerss and layer varieties developed by Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India.

Experimental chicks and procedure. A total of 1120 chickens i.e. 280 numbers of each variety with straight-run chicks were used in the study. All four varieties were obtained from the Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India. Chicks from four varieties (ASL, ARW, NN, NNB3) were divided in to control (C) and heat-exposed (H) groups. The heat stress conditions applied in the present study attempted to mimic the natural environment conditions of tropical regions, where temperatures increase with the intensity of daylight. Relative humidity was not artificially controlled. The C chicks were reared in atat ambient temperature (28±1°C). H group chicks were exposed to 39±1º C for 2 hours daily during 0-2 weeks and 5-6 weeks of age, in the thermal chamber using thermostat-controlled equipment. Chicks from the H (HE – Heat exposed) group and a sample of chicks from the control group (CE – Control exposed) were exposed to 39±1°C for 4 hours daily on the 12th week of age. At the end of thermal conditioning and thermal challenge cloacal temperature was recorded.

Sample collection. At the end of the14th and 42nd d blood samples were collected from six birds of each group from the brachial vein (wing vein). Serum was separated by centrifuging at 2000 rpm for 10 minutes and used for T3 estimation. Six birds from each group were sacrificed on 84th d and liver tissue was collected and stored with RNA later at -20º C for further use.

Triiodothyronine (T3) estimation. T3 levels in serum samples were estimated using the Radioimmuno assay kit (Immunotech, Czech Republic). The antibody-coated tubes were added with 25 µl of calibrators to the standard tubes labelled as 0, 0.75, 1.5, 3.0, 6.0,, and 12.0 nmol, and control sera containing aa known level of triiodothyronine and unknown samples were taken in duplicate. 125i-labeled triiodothyronine tracer (200 µl) was added to all the tubes and mixed well. The tubes were incubated at 20˚C for 1 hour in an an orbital shaker. The contents have aspired carefully. The radioactivity of the tubes was counted for 1 min in the gamma counter (Stratec, Germany). 200 µl of tracer was added to 2 additional tubes and the radioactivity was measured using a gamma counter to obtain total counts per minute. The hormone level was expressed in ng/dl.

RNA extraction. Total RNA was extracted from liver samples using TRIzol™ (Invitrogen, California, USA) according to the manufacturer’s instructions. The quantity and quality of the extracted RNA were confirmed by spectrophotometry (NanoDrop ND-1000); the quantity was measured in ng/μl, and the purity was determined based on the A260/A280 and A260/A230 ratios. cDNA synthesis: RNA (1000 ng) from liver samples was reverse transcribed with the Prime Script First Strand cDNA Synthesis Kit (Takara, Japan) according to the manufacturer’s instructions using a mix of random hexamers and oligo-dT primers.

Primers. Custom-synthesized oligonucleotides were procured from Eurofins Genomics. Details of primer sequences for genes with their annealing temperatures were presented (Table 1).

Table 1.  List of oligonucleotide primers for Real-time PCR

GenesSequence (5′–3′)Product Size (bp)Annealing Temperature (ºC)
Hsp90F-GCATTCTCAGTTCATTGGCTACC R-CTGTCTTCTCCTCCTTCTCCTCT  12264
Hsp70F-ATGAGCACAAGCAGAAAGAG R-TCCCTGGTACAGTTTTGTGA9559
Hsp60F-AGAAGAAGGACAGAGTTACC R-GCGTCTAATGCTGGAATG  11664
Hsp20F-GCGACCAGCCAGGAAGAAGAA R- GGGTCCGTGCTGTGCTTTGA12664
β-actinF-GAG AAA TTG TGC GTG ACA TCA R-CCT GAA CCT CTC ATT GCC A15262

Quantitative Real time Polymerase Chain Reaction. The relative expression of specific gene mRNA was quantified by a a real-time PCR detection system (Applied Biosystems Thermal Cycler – 96 plate). A total volume of 10 µl reaction mixture was prepared with 5 µl of 2X SYBR Green Premix Ex Taq (Takara, USA), 0.5 µl of forward and reverse primer each (5 picomoles concentration), 1.0 µl of complementary DNA and nuclease-free water. The qRT-PCR thermal cycler conditions were set at initial denaturation at 94oC for 5 min followed by 40 cycles of denaturation at 94oC for 10 s, annealing (* as indicated in Table 5) and extension at 72oC for 30 s, subsequent melting curve standards was performed to melt primer dimers by heating from 65oC to 95oC for 10s. All the samples were run in duplicate with no template control (NTC) included in each PCR reaction for all the genes to check the DNA contamination. The melting curve for each of the targetss was checked to ascertain specific amplification before the cycle threshold cycle (Ct) values were recorded. The Ct values of the HSP 90, 70, 60, and 20 mRNA in samples were subtracted with the corresponding Ct value of the β-actin to obtain the DCt values. This DCt value of the sample from the treatment group was subtracted from DCt value of the control sample to obtain DDCt values. The results of the HSP70 mRNA expression levels were expressed as fold change (2–DDCt) over the control [10].

Statistical Analysis. The data obtained on various parameters were statistically analyzed as per the method of Snedecor and Cochran [11] using the the computerized software programme SPSS Version 20.0 and post hoc analysis was carried out using Duncan’s for  multiple comparisons. One-way Analysis of Variance (ANOVA) and Independent T-test were used to compare means between the groups. Statistical analyses were completed with GraphPad Prism 7 (La Jolla, CA).

Results

Cloacal temperature

            The Cloacal temperature was significantly (p<0.01) higher in the H group, irrespective of varieties at on the 14th and 42nd dayss. Among the variety, ARW and NN had the the higher temperature on the 14th day, whereas NN and NNB3 had the higher temperature at the 42nd day (Table 2). The Cloacal temperature in the HE group was significantly (p<0.01) lower than CE and significantly (p<0.01) higher than C group on the 84th day in all four varieties (Table 3). Among the varieties, NN had a a significantly high temperature. The present findings with respect to cloacal temperature in Naked neck strain was were in agreement with the result of Amrutkar [12] observed an increased cloacal temperature in heat-stressed CARIBRO-Tropicana (Naked neck gene bearing) birds when compared to control birds. Whereas the present findings were in disagreement with the result of Gunal [13] who reported that there was a significantly decreased cloacal temperature (42.11o C) in the heat-exposed groups when compared with the the unexposed control (42.34o C) group.

Table 2. The cloacal temperature of Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW), and Naked neck x Nandanam broiler-3 (NNB3) at thermal conditioning on 14 and 42nd d of age


Variety
Cloacal Temperature (oC)
14th day42nd day
CHt valueCHt value
Aseel39.97bB±0.1341.18bA±0.127.83**40.48B±0.1541.96bA±0.355.27**
ARW40.25abB±0.1441.69aA±0.097.93**40.68B±0.1342.44abA±0.568.74**
NN40.49aB±0.1541.65aA±0.056.14**40.91B±0.1442.91aA±0.299.82** 
NNB340.46aB±0.1141.56aA±0.087.46**40.79B±0.1542.89aA±0.288.17** 
F value3.36*6.589** 1.543NS6.808**

a, b Means with different superscripts in a column differ significantly within a variety

A,B Means with different superscripts in a row differ significantly within the the treatment

NS-non Significant (p>0.05), *-Significant (p<0.05), ** Highly Significant (p<0.01)

Table 3. The cloacal temperature of Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW), and Naked neck x Nandanam broiler-3 (NNB3) at the thermal challenge on 84th d of age

  VarietyCloacal Temperature (oC) – 84th day
CHECEF value
Aseel40.17bB±0.2440.24bB±0.2341.98bA±0.1424.22**
ARW40.39abC±0.1841.35aB±0.2142.04bA±0.1918.22**
NN41.13aC±0.2441.33aB±0.2542.88aA±0.2216.06** 
NNB340.99aC±0.3141.19aB±0.2542.48abA±0.249.01**
F value3.475* 5.173* 4.2018* 

a, b Means with different superscripts in a column differ significantly within a variety

A,B Means with different superscripts in a row differ significantly within the the treatment

*-Significant (p<0.05), ** Highly Significant (p<0.01), (C- Control; CE- Control exposed; HE-Heat exposed)

Moreover, at a a higher temperature, birds were unable to excrete the heat into the environment through evaporative losses which leads to more vigorous panting to excrete heat through evaporation which leadss to increased muscle movement during panting which increases the body temperature [14]. The results indicate that all the four strains were most affected at the first exposure of thermal stress. However,, in subsequent stages of exposure, these birds indicate the sign of acclimatization by controlling their cloacal temperature towards normal. The phenomenon of acclimatization under prolonged stress is well-documented in poultry and other animals. Among the variety, Aseel had the lower cloacal temperature at the thermal challenge. It shows the sign of adaptation or acclimatization towards thermal stress.

Triiodothyronine (T3) concentration

            On the 14th and 42nd d, irrespective of all the four varieties, T3 concentration was significantly (p<0.01) lower in the H group when compared with the control (C) group (Table 4). Among the variety, ARW and NN had significantly (p<0.05) lower T3 concentrations on 14th and 42nd d, respectively. However in at 84th day CE group, sudden exposure to high temperature for longer duration had significantly (p<0.01) lower T3 concentration, while the pre-exposed group (HE) had significantly higher T3 concentration and was also comparable with the the control (C) group (Table 5). Among the varieties, NN had a a significantly lower T3 concentration. Metabolism in birds during growth and production was regulated by thyroid hormone; therefore it is important in of chicks to heat stress. On the 14th and 42nd day, the T3 concentration was significantly lower in heat-exposed birds due to the stress condition immediately after exposure to high temperature. At 84th d, the T3 concentration was significantly lower in the  CE group indicating the stress condition of birds.   The T3 concentration in HE group was significantly higher than CE and significantly lower than C group on 84th d in all tfour varieties, indicating that those birds were adapted to higher temperature during re-exposure to heat stress.

Table 4. T3 concentration of Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) at thermal conditioning on 14 and 42nd d of age


Variety
Triiodothyronine (T3) (ng/dl)
14th day42nd day
CHt valueCHt value
Aseel1.993A ±0.0091.730bB ±0.0269.16**2.093bA ±0.0081.963aB ±0.0095.68**
ARW2.017A ±0.0241.720bB ±0.0217.04** 2.117abA ±0.0181.873bB ±0.0189.16**
NN2.047A ±0.0211.787aB ±0.0218.22**2.163aA ±0.0091.793cB ±0.0226.46**
NNB32.030A ±0.0061.793aB ±0.0296.81**2.157aA ±0.0241.823bcB ±0.0326.93**
F value1.845NS2.398*4.107* 11.581** 

a, b Means with different superscripts in a column differ significantly within a variety

A,B Means with different superscripts in a row differ significantly within the treatment

NS-non Significant (p>0.05), *-Significant (p<0.05), ** Highly Significant (p<0.01)

Table 5. T3 concentration of Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) at thermal challenge on 84th d of age

VarietyTriiodothyronine (T3) (ng/dl) – 84th day
CHECEF value
Aseel2.097bA ± 0.0241.987aB ± 0.0151.743aC ± 0.012105.08*
ARW2.127abA ± 0.0191.963abB ± 0.0091.693abC ± 0.009287.36**
NN2.173aA ± 0.0121.920bcB ± 0.0061.660bC ± 0.015480.76**
NNB32.180aA ± 0.0151.950cB ± 0.0061.667abC ± 0.027196.17**
F value4.818*8.708**4.775*

a, b Means with different superscripts in a column differ significantly within a variety

A,B Means with different superscripts in a row differ significantly within the treatment

*-Significant (p<0.05), ** Highly Significant (p<0.01), (C- Control; CE- Control exposed; HE-Heat exposed)

The decreased feed intake, together with a decreased circulating thyroid hormone levels, resulted in lower metabolic and thermogenic rates, which is is reflected by a a decrease in animal production during exposure to stressful heat conditions [15]. The importance of thyroid hormones in adaptation to heat stress was related to the key role of this hormone in the regulation of metabolic rate in birds. Heat stress markedly depresses the activity of the thyrotrophic axis in birds which is is reflected by a a decrease in the plasma/serum T3 concentration, resulting in functional hypothyroidism. Heat-conditioned birds had a significantly improve thermo tolerance. The improved thermotolerance was indicated by a significantly lower metabolic rate and significantly declining T3 levels [16]. Similar findings were reported, [3] in selected broiler chickens, pre-exposed to higher temperatures during incubation, which were attributed to the epigenetic adaptation. Significantly lower levels of T3 concentration and lower metabolic rate were observed in thermally conditioned chicken [17]. The present findings with respect to decreased T3 levels in the NNB3 broiler strain were in agreement with the findings of Vinoth et al., [18] reported that there were  significantly decreased T3 levels in the heat-exposed Punjab broiler-2 birds, when compared with control birds.

HSP expression

            The mRNA expression of all the four HSP genes in the liver viz., HSP 90, 70, 60,, and 20 were significantly (P<0.01) higher in H group in all the four varieties (ASL, ARW, NN,, and NNB3) when compared to control (C) birds. CE (suddenly exposed) group chicks, that were not exposed to high temperature during early age had significantly (P<0.01) higher m RNA expression for all the HSP genes, while earlier exposed birds (HE) had significantly (P<0.05) lower gene expression in all the four varieties on 12th–week thermal challenge i.e., re-exposure to high temperature on 84th day, indicating the lesser stress due to pre-adaptation (Fig. 1). Out of all HSP genes, HSP 70 is more expressive in all the four varieties followed by HSP 90, 60, and 20. Within a a variety, ASL and ARW had higher expression of HSP genes when compared to NN and NNB3. A strong positive correlation exists between body temperature and HSP synthesis which was also similar in the present study. The H group had significantly higher HSP levels immediately after exposure to high temperature due to  the increased stress condition of the birds in order to maintain the thermoregulatory mechanisms in the body on 14th and 42nd day. CE group chicks, which were not exposed to high temperatures during early age, had higher mRNA expression for all the HSP genes, while earlier exposed birds (HE) had lower gene expression in all four varieties on  the thermal challenge.

            When birds exposed to thermal stress, the synthesis of most proteins is delayed, but a group of highly conserved proteins known as heat shock proteins or heat stress proteins is rapidly synthesized [19] which helps in the survival of stressed cells and the stabilization of the internal environment. According to the molecular weights, HSP can be classified into 3 main families: HSP90 (~85-90 kDa), HSP70 (~68-73 kDa) and low molecular weight HSP (~16-47 kDa). Among the HSPs, HSP 70 is one of the most conserved and important protein families and has been extensively studied [20]. The HSPs act as molecular chaperones that help in protein folding and assembly, and assist in restoring the native state of the the protein [21]. HSPs synthesis up-regulation under different stress conditions is an adaptive phenomenon resulting in improved thermo-tolerance. There exists a relationship between thermo-tolerance and HSPs synthesis in all living organisms. The liver is one of the high metabolically active organs and therefore, comparatively more susceptible to heat stress than other organs. Acute heat stress increased HSP90α, HSP90β, HSP70, and HSP60 expressions in broiler liver [22] [23] reported an increase HSP-70 expression in three chicken lines (Kampong, Arabic, and commercial) when exposed to acute heat stress (40˚C for 0, 0.5, 1.0,, and 5h).

            Pre-natal thermally manipulated colored broilers reared at high ambient temperaturess had lower HSPs expressions in different tissues [3, 24]. There exists breed differences, Naked Neck chicken had no or variable effect of thermal manipulation (TM) in earlier reports.


cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   A
cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   B
aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   CcHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   cHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   bHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   aHeat shock protein (HSP) gene expression in liver of Naked neck (NN) chicks at 42nd day of age. (C- Control; CE- Control exposed;HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. a, b Means with different superscripts differ significantly (P<0.05)   D

Figure 1. Heat shock protein (HSPs) genes expression in liver sample at 84th d. (C- Control;
CE- Control exposed; HE- Heat exposed). A. ASL, B. ARW, C. NN, D. NNB3.
a,b,c Means with different superscripts differ significantly (P<0.01)

This may be due to lesser feather coverage in the Naked Neck chicken that helped in dissipating excess body heat than the colored broiler. Heat conditioning of 5-7 day-old chicks on the the subsequent thermal challenge at 42nd day had decreased HSPs 27, 70, and 90 expressions in heart, liver and lung tissues [18]. It is clear from these reports that TM during incubation or aearly age confers thermo tolerance during the later stage of life and this thermo tolerance is achieved through lowered body temperature during the stress period. Furthermore, lower HSPs levels in thermo-tolerance birds indicate lesser damage to the cellular structures. Pre-exposure to high temperature induces physiological memory due to epigenetic adaptation to high temperature resulting in improved thermo tolerance during the post-natal life [25].

            The birds on re-exposure to thermal stress on 84th day showed significantly lower HSP levels in HE group indicating the adaptation of birds to high temperature as a result of pre-conditioning. In the the CE group, the HSP levels were significantly higher indicating the effect of thermal stress in the birds. This clearly substantiates the hypothesis of pre-thermal conditioning has advantageous effects during later stages of life due to epigenetic adaptation in chickens [24, 25].

            In summary,  it was concluded that the thermal conditioning of chicks during early age had a a positive effect and improves the thermal tolerance of the chicks in post-natal life as revealed by the reduced expression of the HSPs gene, temperature,, and improved T3 levels as stress indicators in native chickens and its cross varieties.

References

Al-Aqil, A. and Zulkifli, I. 2009. Changes in heat shock protein 70 expression and blood characteristics in transported broiler chickens as affected by housing and early age feed restriction. Poult Sci. 88, 1358-1364.

Amrutkar, S.A. 2012. Evaluation of Frizzle, Naked neck and normal plumaged broilers under tropical stress conditions using functional genomics and epigenetic tools. Ph.D. thesis submitted to Deemed University, Indian Veterinary Research Institute, Izatnagar.

Benjamin Ivor J and D. Randy McMillan, 1998. Stress (Heat Shock) Proteins Molecular Chaperones in Cardiovascular Biology and Disease. Circ Res. 83: 117 – 132.

Duangduen, C., Duangjinda, M., Katawatin, S. and Aengwanich, W. 2007. Effects of heat stress on growth performance and physiological response in Thai indigenous chickens (Chee) and broilers.  Kasetsart Veterinarians. 17, 122–133.

Etches, R.J., John, T.M. and Gibbins, A.M.V. 2008. Behavioural,  physiological, neuroendocrine  and  molecular  responses  to  heat  stress,  in  Daghir,  N.J.  (ed.)  Poultry Production in Hot Climate.  Second edn. Wallingford, UK: CAB international, 31-66.

Fotsa, J. and Mérat P Bordas. 2001. A Effect of the slow (K) or rapid (k+) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn x brown egg type cross. Genetics Selection Evolution. 33, 659–670.

Guerreiro, E. N., P. F. Giachetto, P. E. N. Givisiez, J. A. Ferro, M. I. T. Ferro, J. E. Gabriel, R. L. Furlan and M. Macari, 2004. Brain and hepatic Hsp70 protein levels in heat-acclimated broiler chickens during heat stress. Rev. Bras. Cienc. Avic. 6(4): 201 – 206.

Gunal, M. 2013. The effects of early age thermal manipulation and daily short term fasting on performance and body temperatures in broiler exposed to heat stress. J Anim Physiol An.  97(5), 854-860.

Hartl, F.U. and Hayer-Hartl, M. 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295, 1852-1858.

Kingori, A.M., Wachira, A.M. and Tuitoek, J.K. 2010. Indigenous chicken production in kenya: a review. International Journal of Poultry Science. 9, 309- 316.

Liang, H. M., D. Y. Lin, Y. D. Hsuuw, T. P. Huang, H. L. Chang, C. Y. Lin, H. H. Wu and K. H. Hung, 2016. Association of heat shock protein 70 gene polymorphisms with acute thermal tolerance, growth, and egg production traits of native chickens in Taiwan. Archives Animal Breeding, 59(2): 173 – 181.

Ming, J., J. Xie, P. Xu, W. B. Liu, X. P. Ge, B. Liu, Y. J. He, Y. F. Cheng, Q. L. Zhou and L. K. Pan. 2010. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih). Fish Shell fish Immunol, 28: 407 – 418.

Piestun, Y., O. Halevy, D. Shinder, M. Ruzal, S. Druyan and S. Yahav, 2011. Thermal manipulations during broiler embryogenesis improves post hatch performance under hot conditions. Therm. Biol. 36: 469 – 474.

Quinteiro-Filho, W. M., A. Ribeiro, V. Ferraz-de-Paula, M. L. Pinheiro, M. Sakai, L. P. M Sa, A. J. P. Ferreira and J. Palermo-Neto, 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 89(9): 1905 – 1914.

Rajkumar, U., A. Vinoth, M. Shanmugam, K. S. Rajaravindra, and S. V. Rama Rao, 2015. Effect of embryonic thermal exposure on heat shock proteins (Hsps) gene expression and serum T3 concentration in two broiler populations. Anim. Biotechnol. 26(4): 260 – 267.

Sharifi, A.R., Horst, P. and Simianer, H. 2010. The effect of frizzle gene and dwarf gene on reproductive performance of broiler breeder dams under high and normal ambient temperatures. Poultry Science. 89, 2356–2369.

Snedecor, G.W. and Cochran, W.G. 1989. Statistical Methods. 8th ed. IowaState University Press, Ames, Iowa.

Staib, J. L ., J. C. Quindry , J. P. French , D. S. Criswell and S. K. Powers, 2007. Increased temperature, not cardiac load, activates heat shock transcription factor 1 and heat shock protein 72 expression in the heart. Am J Physiol Regul Integr Comp physiol. 292: 432 – 439.

Tamzil, M. H., R. R. Noor, P. S. Hardjosworo, W. Manalu and C. Sumantri, 2013. Acute heat stress responses of three lines of chickens with different heat shock protein (HSP)-70 genotypes. Int. J. Poult. Sci. 12(5): 264 – 272.

Vinoth, A., Thirunalasundari, T., Shanmugam, M. and Rajkumar, U. 2016. Effect of early age thermal conditioning on expression of heat shock proteins in liver tissue and biochemical stress indicators in colored broiler chicken. Eur J Exp Biol. 6(2), 53-63.

Vinoth. A ., T. Thirunalasundari , J. A. Tharian , M.  Shanmugam , U.  Rajkumar, 2015. Effect of thermal manipulation during embryogenesis on liver heat shock protein expression in chronic heat stressed coloured broiler chickens. J Therm Bio. 53: 162 – 171.

Wong, M.L. and Medrano, J.F. 2005. Real-time PCR for mRNA quantitation. Biotechniques. 39(1), 75-88.

Yahav, S. 2009. Alleviating heat stress in domestic fowl – different strategies. World Poult Sci J.  65, 719-732.

Yahav, S. and McMurtry, J.P. 2001. Thermotolerance Acquisition in Broiler Chickens by Temperature Conditioning Early in Life the Effect of Timing and Ambient Temperature. Poult Sci. 80(12), 1662-1666.

Zhang, W.W., Kong, L.N., Zhang, X.Q. and Luo, Q.B. 2014. Alteration of HSF3 and HSP70 mRNA expression in 490 the tissues of two chicken breeds during acute heat stress. Genet Mol Res. 13, 9787-9794.

Similar Posts