Development of novel SNP/InDel markers through amplicon sequencing in dolichos bean (Lablab purpureus L.)

Venkatesha S.C1* , Prakash G. Patil 2

1Department of Biotechnology and Crop Improvement, University of Horticultural Sciences (UHS), Bagalkot, Karnataka 587104, India

2ICAR-National Research Centre on Pomegranate (NRCP), Solapur 413 255, India

Corresponding Author Email: patilbt@gmail.com

DOI : https://doi.org/10.5281/zenodo.7629782

Download this article as:

Abstract

Despite the advances made through genomics research in Dolichos bean, the availability of informative molecular tools is still limited. The expressed sequence tags represent the robust sequence resource for the development of novel genic markers that can be exploited for gene discovery, genome annotation and comparative genomics. Here we first time report the development of novel EST-derived SNP and InDel markers through amplicon sequencing of cross-transferable cowpea EST-SSR primers in Lablab bean. Total of four polymorphic cowpea EST-SSRs viz., CP2, CP8, CP29, and CP435, with a high transferability rate in Dolichos bean were identified. Sequenced total 18 genic fragments from nine parental genotypes, which resulted in the identification of 59 SNPs and 16 InDels. Based on these sequence variations, we successfully designed and validated eight allele-specific markers i.e. Met 2, AF 287258-1, AF 285278-2, AF 151961, D 13557, CP 5, CP16 and CP 43, which are targeting SNPs/InDels in Lablab bean. Further, to prove their immediate utility for trait mapping the parental polymorphic markers were genotyped on F2 segregating lines derived from the two crosses i.e. HA4 × CPI31113 and HA4 × CPI60216. Segregation analysis revealed that these markers exhibited a typical Mendelian segregation ratio of 1:2:1 with co-dominant allelic patterns for SNP/InDels. This confirmed the immediate utility of such novel genic markers for future genomics-assisted breeding applications in Dolichos bean.

Introduction

Dolichos bean (Lablab purpureus L. Sweet, Fabaceae) is one of the oldest cultivated plants, with records dating back to 1500 BC in India [1]. The plant is presently grown throughout tropical regions in Asia and Africa either as mono-crop or mixed crops [2]. Lablab is a highly nutrient-dense legume crop, which is more resilient to biotic and abiotic stresses can thrive well under marginal areas, and is more vital to diversify diets, amplify sustainable farming, and mitigate climate change and its effects [3]. The pods are rich in proteins (22.4–31.3%) and carbohydrates (55%) and also contain vitamins and minerals such as copper, potassium, magnesium, iron, and phosphorus, are fibre-rich and are suitable for human nutrition [4]. Therefore, it is a multipurpose crop grown for pulses or vegetables for human consumption or as forage for animals [5].

For any crop improvement program, it is most vital to characterize for domestication and collection of the elite and promising genotypes of the Dolichos bean with high yielding potentialities for food and fodder purposes [2].  Yield, being a complex trait, is collectively influenced by various component characters, which are polygenically inherited and highly influenced by environmental variations. Therefore,  wide phenotypic variability was observed with little genetic diversity in the dolichos bean [6-8]. However, the use of inter-species crosses to produce lines with desirable traits, such as yield improvement or disease and pest resistance, has been one way to overcome the genetic bottleneck of crop plant domestication. This breeding approach, of inter- (or wide intra-) specific crosses, can benefit from good genetic maps, with robust markers anchored to reference genomes that are available from comparative genetic maps.

There are very few sequences available for lablab, but there is a vast amount of sequence data available from related legume species. Comparative mapping within the legume crop and model species provides evidence that this wealth of sequence data can be used for genetic analysis even in neglected legume species such as Dolichos [9]. Previous studies have shown lablab genome had a high syntenic relationship with Vigna radiata (mungbean) [10]. Till date, there is no well-saturated genetic map available and no trait-specific markers identified in dolichos bean. Therefore, a well-saturated genetic map based on genetic markers is a necessity for genomics-assisted breeding. Towards this end, the availability of informative marker resources in dolichos bean holds greater promise. Thus, the objective of the current study was to develop and validated gene-based SNP/InDel markers for genetic mapping work. For this we followed one of the highly targeted approaches called amplicon sequencing method, where in sequencing of PCR products has allowed many research in efficient variant detections in gene fragments followed by development of genic markers.

Material and methods

Plant material and genomic DNA extraction

The experimental material constituted ten Lablab purpureus genotypes, which represented both exotic and indigenous origin along with one cowpea genotype as a control (Table 1). For validation of polymorphic markers two F2 mapping populations were used. The experiment was laid out at department of plant biotechnology, University of Agricultural Sciences, Gandhi Krishi Vignana Kendra, Bengaluru. The seeds of these genotypes were obtained from the department of Genetic and Plant breeding, and the health plants were raised under plastic cover filled with red soil mixture having sand (2:1). For isolation of genomic DNA,  two to three young leaves were collected from 25 day old seedlings. The  extracted was performed  by following SDS method [11], with minor modifications. The quality and concentration of all the DNA samples were assessed on 0.8 % agarose gels using uncut ʎ DNA as a standard.

Table 1: Details of 10 Lablab accessions used for screening gene specific markers

Sl. No.Lablab accessionsCountry of origin
1HA3India
2Mac-1India
3SRLIndia
4RongaiKenya
5HighworthEx. India
6CPI36903Ex. Ukrane
7CPI52544India
8CPI52552India
9CPI52535India
10ILRI6536Ex. Ethiopia

Primer designing and parental polymorphism study

We explored EST sequence information available on cowpea genomic database (http://cowpeagenomics.med.virginia.edu/CGKB), and designed 32 genic EST-SSR primers using Primer 3 tool.  These primers could amplify the expected product size range of 200-300 bp for easy separation on agarose and acrylamide gel electrophoresis. In addition to this, 26 additional EST-SSR primers were obtained from Virginia University, USA. A total 58 EST-SSR primers were deployed for parental polymorphism study on nine lablab genotypes including one cowpea, which is listed in Table 2. The polymerase chain reaction (PCR) was performed in a 10μl reaction volume containing 20 ng genomic DNA as a template, 0.1 μM of each forward and reverse primer, 200 μM each dNTP, 0.5 unit of Taq DNA pol enzyme (Invitrogen, UK) and the appropriate reaction buffers. The reaction conditions were as follows: touch-down cycling regime with 940 C/3 min; (940 C/30 s; 580 C/30 s; 720 C/60 s) repeat for 10 cycles reducing the annealing temperature by 0.50 C/cycle; (940 C/30 s; 530 C/30 s; 720 C/60 s) repeat 34 cycles; 720 C/10 min; 120 C/30 min. The PCR products were separated on 2 % agarose gel electrophoresis, visualized and photographed using gel documentation unit. The primer products, which could not be resolved on agarose gel were separated on 5% horizontal polyacrylamide gel stained with Ethidium bromide or Silver nitrate staining as per the standard procedure [12].

Table 2. Cowpea specific EST-SSR primers designed and deployed for screening on Lablab genotypes

Sl. No.Primer NameSequence forward ( 5’ to 3’)Sequence reverse ( 5’ to 3’)
1CP1TTGGAGAGGGACAAAATTGCATTGTGCCACGTGGTAGTGA
2CP2TCCTTTCTCTGCCTCAGGTGGCTCTTTGCCTCCATTCTCC
3CP3ACCGGTGAAAGTAGGACCACGGCTGATTGATCTGGCCATC
4CP4GGAGTTAGCCCACTCTCGTTCCAGAGCCTCTCCACTACTACAGC
5CP5AGCTCCTCATCAGTGGGATGCATTGCCACCTCTTCTAGGG
6CP6GGGGGAGAGAGAGAGAGAGAGATTCTCCCCCTATGTGGACCT
7CP7GAGGAGGAGGAGGATCTGACACTTCTGCAGGCTTGTGGTTC
8CP8ACCATAGCAGCTCCCCATTCGGTCTAGGACAAGGTCCTGGTAG
9CP9AGGAGGAGGAGGAGGAGGAGGTCTGGGAGACCTGGATTAGC
10CP10AGGAGGAGGAGGAGGAGGAGGTCTGGGAGACCTGGATTAGC
11CP11CCACAGTGGAAAACCACACCGGTGGTGGTGGAGTGAAGAG
12CP12CACTCATCTGCCTCTCAACGGCAGTCTACTCCCAGTACCACAC
13CP13CACCACCACTCCAAAGAAGCCTAACGCTGCAGCCTCATCA
14CP14GGTTTATGGGTGGGAGGTGTGTATCTGGCTGTCGTGACCA
15CP15ACGAGGCTCAAGATCAGACGGGAGCTCTTCCTTGAGAGTGG
16CP16CACCCTTCACCACCGTTTACGTACACGAGGTGCTCCATTCC
17CP17ACCACCACCACTGTTCTTCTTCTTACCTTCTGGACTGGGAGAGA
18CP18GTGTAAGAAGCATGCAGAGGTGAGTACTAGAATGGGGCCATGTG
19CP19CTTCCCTGTGTTGCTGTTACTGCTCGCACGAGTAGAAGAGAAGA
20CP20AAGTCCTTACACCACCACTCCAGAGTCCGAAGAACGACTTGTG
21CP21CTCTCTCCATTCCCAAGTGTCTGAAGAAGAACAGTGGTGGTGGT
22CP22AGATGTCGCTCCCTCTGTTGGAGGAGGAGGAGGAGGAGAAG
23CP23CGAGGGAGTACGAGTTCAGCGTCTCGACCTTGACGTCGTT
24CP24AGCGTCAGAGACTGGGAAGAGAAGAGAGAGTGGTGGTGGTG
25CP25GGTGGCAATGAGCCTTACACAGATGTGGAGGGCATGGTAG
26CP26CGACCACCATAACTCGGAAGGGGAGAAACAGAGGGAGAGAG
27CP27CGCAACTCACCTTTCCTCAGCGTTGAGATGCAGGGAGAAC
28CP28CGCAACTCACCTTTCCTCAGCGTTGAGATGCAGGGAGAAC
29CP29TCTCGAGAACGATGGTGGAGAAGGACTGAAGCGAGAGACG
30CP30GCGTGTCTTGCCAACTTCTCATATCCTCCTCCTCCACCAC
31CP31GCTACATAGTCCCCACCAAGCTGTCAGATCCTCCTCCTCCTC
32CP32CGACTCCACCTTGTTCTTGCGGTGGTGGTGACAGAGTGAAG
33CP115GGGAGTGCTCCGGAAAGTTTCCCTATGAACTGGGAGATCTAT
34CP117GTGGAAGGAATGGGTCCAGAGGAAATTTGCATTCCCTTGT
35CP163CACTTTCTCCTAAGCACTTTTGCAAGTGAAGCATCATGTTAGCC
36CP171GTAGGGAGTTGGCCACGATACAACCGATGAAAAAGTGGACA
37CP181GGGTGCTTTGCTCACATCTTTCCATGTGTTTATGACGCAAA
38CP197TGAATGGAGCAACTTCTTGGAGTTGCACTTGGTTGCCCTAT
39CP201GGTTTCCTAGTTGGGAAGGAAATTATGCCATGGAGGGTTCA
40CP215CAGAAGCGGTGAAAATTGAACGCATGTTGCTTTGACAATGG
41CP239CACCCCCGTACACACACACCACTTAAATTTTCACCAGGCATT
42CP333CAAAGGGTCATCAGGATTGGTTTAAGCAGCCAAGCAGTTGT
43CP359TGAAAACAACGATATGCAGAAGTCAGTCTTAGAATTGAGTTTTCTTCG
44CP391TGCCTATGCTTATGCCTGTGGATGCCTGTTACTTGCCTTCT
45CP395GTTGTGAGCTTCCCCAGATGAATTTTGAACCCACCACCAG
46CP397TCATGGGTTAAATTTGCTTCAAAAACCATGTGGTTGTTGCAC
47CP403TGCAATATGGACCAGAAGAAAATGCCCCAACAACAACATTT
48CP431CCTCAACACCTTTTGGAAGGACAAATGCACCTCCTGTGCTA
49CP433CAACTTCACAGCCCTCAATTGAAGGTATGGCCTTTTGTTT
50CP435TGCTCATCGTGCTTTGTCTTCACTTCAGACTTAGAGCGAAGAA
51CP443GCTCGGATATGGTCCTGAAATCAGTGTCAGCACCATCCC
52CP573CAGAATCCTTGTGAACCTGTTTCGCAATATGCCCTTTTC
53CP605AAAGAGATACACATGCCTAACAGACCAACAGCGACTTTGAGC
54Y1GATATAGAATAGCATATTTAACATATTAGGTTGAAAGTTTGATAGTAAAGTGG
55Y21GAGAACTTCACGCACAATAGCGCGGTAGCATGATTGAATTTTG
56Y26CTAAATTATAATATTCGTCGGTCGGTTAAGGAAAAGAGGGTAGG
57Y31CTATTGGAATCTTGCCGTTGCTTTACCTTTATGCAAACCAATTC
58Y45CGATTATCCTGGCTAACGATGGGATCTGAGATAGTGTGAC

Identification of SNP’s and InDels through sequencing of genic fragments

The highly polymorphic cross transferable cowpea EST-SSRs were identified in Dolichos genotypes through parental polymorphism study. Total 23 primers with specific amplifications in Lablab accessions were selected (Table 3). The sequencing experiments were performed at JIC genome lab, Norwich, UK. For sequencing parental genotypes were first amplified using specific primers. PCR was performed in 10µl reaction volume by following touch-down cycling regime as already mentioned above for parental polymorphism study. The sequencing was done using Big dye V 3.1 terminator mix. The 1μl of PCR amplified products were used as template in 10µl reaction volume constituting 1μl of Big dye, 1 μl of sequence buffer, 1μl of 3.2 μM each specific primers for re-amplifications. PCR conditions followed as: 960 C/1 min; (960 C/10 s: 560 C/5 s; 600 C/4 min) repeat for 24 cycles: 100 C 10 minutes. Finally, all the PCR amplified DNA fragments were sequenced using DNA analyser from ABI. All the sequenced genetic fragments were analysed for SNP and InDels using Bio-Edit tool [13].

Table 3. Genic fragments targeted for sequencing in Lablab accessions

SL No.Genic fragmentsAmplicon size in base pairs
1CP2220
2CP5300
3CP8200
4CP15200
5CP16250
6CP23200
7CP32200
8CP117150
9CP171220
10CP181250
11CP215180
12CP403150
13CP431250
14CP435170
15Y1300
16pDLL200
175S rRNA300
18fril300
19Met11000
20Met2800
21AF 151961400
22AF 287258400
23D 13557800

Designing of SNP and InDel specific primers

In order to develop allele specific markers, the SNPs/ InDels identified based on the sequencing results of genic fragments were deployed. For primer designing Batch Primer, 3 tool was used.  We have used tri- and tetra- primer [14, 15] methods to distinguish the allelic differences. In tri primer method, two outer primers and an inner primer was used in a single PCR reactions to generate common band in both the genotypes and single band in one of the genotype. In tetra primer method, two inner primers and two outer primers were used in a single PCR reaction to generate common bigger band in both the genotypes and two different sized small bands differentiate two alleles. The inner primers were designed based on the SNPs; in addition to SNP base a second deliberate mismatch was incorporated at position -2 from the 3’ terminus to enhance the allelic specificity. The sequence details of the allele specific primers designed are shown in Table 4.

Table 4.  Sequence details of the allele specific primers

Sl. No.Primer nameSequence ( 5’ to 3’)
1.Met2_AS_CPI24973 ATATCCGTTGTGTAAATTTCGCT 
2.Met2_AS_HA4ATTAGAAAACAAACAAGTTTAGT
3.CP5_AS_CPI24973TCTTAATATGGAAAAAGATAT
4.CP5_AS_HA4AGAGACAACAAAGGATCTCTGTC
5.AF287258_ AS1_ 31113AGGCTTCCCTTTTTATTTTTCTACG
6.AF287258_AS1_ HA4ACACATGGGGATTCAATAAACATT
7.AF287258_AS2_31113ACTCTTCCTATAGTGAGAACCTTATTGC
8.AF287258_AS2-HA4AAGAAAAATAAAAAGGGAAGCGTA
9.CP16_AS_31113TGGCCTTGTTTCTGTCTCAACG
10.CP16_AS_HA4AAGAATGATGCCATTGGAGATAT
11.CP431_AS_31113TGCTTGTAGCACCAAAACCG
12.CP431_AS_HA4ATTTGGTGCTACTAGCACCGCT
13.D13557_AS_31113TGTAACTGAGGGTGCTTGTTGACTG
14.D13557_AS_HA4TTTTTAAATCCTTATGGCGTTTCAGAT
15.AF151961-AS-31113AGATCCATAACCCCAAAGGAATTTTC
16.AF151961-AS-HA4ACCTGATTCTCTGCTAAACCCATTAGA

             Note: Red colour indicates the SNP

Blue colour indicates the altered base at second position from the 3’ end SNP

Wet lab validation of allele-specific markers

For wet lab validation of newly designed allele-specific primers, three parental genotypes were screened HA4, CPI31113 and CPI60216. For the screening of SNP/InDel markers, we kept PCR components the same with altered number of SNP-specific primers based on the genotyping methods. The PCR conditions remained same with different annealing temperatures for each primer combination as used for amplifying genic fragments. All the amplification products were separated on 2% agarose gels and scored for common, co-dominant and dominant allele profiles to record all the allelic variations.  Further, the polymorphic allele specific markers were subjected to genotyping of two mapping populations HA4 × CPI31113 and HA4 × CPI60216, with 80 and 90 F2 individuals. The female-specific allele scored as ‘A’, male as ‘B’ and the heterozygotes as ‘H’ across F2 individuals. Finally by counting the marker allele scores examined for 1:2:1 Mendalian ratios, as expected in case of co-dominant markers.

Results and discussion

Parental polymorphism study using Cowpea EST-SSRs in Lablab bean

For construction of a genetic map followed gene(s)/QTLs analysis, parental polymorphism study between contrasting parents is very much crucial. It is critical that sufficient polymorphism exists between parents in order to construct saturated genetic maps to fine map the genes [16]. Generally in inbreeding species like Dolichos bean requires the selection of parents that are highly divergent. In most of cases, parents that provide adequate polymorphism are selected on the basis of the level of genetic diversity between parents [17- 20]. In this study we deployed a total 58 cowpea genic EST-SSR primers for parental polymorphism study in Lablab bean. Among these, 45 primer pairs generated good amplification profiles in lablab genotypes with reproducible bands. This high rate of amplification of cowpea primers in Lablab bean indicates high rate of marker transferability between these two species. Similarly, high SSR marker transferability between these two species was reported [21]. Out of 45 primers screened, 14 generated multiple bands, 3 double bands and 28 with single band amplifications in all the nine parental genotypes with amplicons size ranging from 100-800 base pairs (Table 5). The lack of amplification for some primers in some of the genotypes could be due to sequence variation at primer binding regions. The primer pairs with multiple and double bands observed in this study need standardization of the PCR conditions.

In our study, none of these primer pairs showed polymorphism on parental genotypes when resolved on 2% agarose gels. This could be due low resolving power as offered by agarose gels as compared to polyacrylamide and capillary-based methods.  Therefore, we used 5% horizontal polyacrylamide gels to resolve DNA variations (Fig.1a), which resulted in the identification of four polymorphic markers viz., CP2, CP8, CP29, and CP435. The very low level of polymorphism reported in the present study indicates limited scope for use of these markers for genetic studies in Lablab bean. Similarly, earlier we reported low levels of polymorphism for cowpea-based markers in lablab bean [8]. Hence, here we performed targeted amplicon sequencing of genic fragments that has allowed efficient variant identification and characterization through the development of EST-SNPs and InDel markers in Lablab bean.

Table 5. Amplification pattern of 58 Cowpea SSR primers in Lablab purpureus genotypes

Sl. No.Primer nameBand size (base pair)Genotypes**Remarks
CPLablab12345678910
1CP1200D (200, 400)––––+++++++–+U*
2CP2200S (220)++++++++ (InDel)++Poly on PAGE, InDels
3CP3200D (200, 800)+++–++++++++U*
4CP4250M(200-1000)––––++++++U*
5CP5300S (300)++++++++++SNPs
6CP6800S (250)++++++++++Mono on PAGE
7CP7200M(200-1000)++++++++++U*
8CP8200S (200)++++++++ (InDel)++Poly on PAGE, InDels
9CP9200S (200)++++++++++Mono on PAGE
10CP10200S (200)++++++++++Mono on PAGE
11CP11200M (450)+–+–++++++Mono on PAGE
12CP12300S (700)––––+++––+Mono on PAGE
13CP13100D (100-300)++++++++++++U*
14CP14600S(800)++++++++++Mono on PAGE
15CP15200S (200)++++++++++Mono on PAGE
16CP16200S (250)++++++++++Mono on PAGE
17CP17200S (200)+++–++++++Mono on PAGE
18CP18220S  (200)+–+–++++––Mono on PAGE
19CP19200––––––––––+No amp in Lablab
20CP20200––––––––––+No amp in Lablab
21CP21250––––––––––+No amp in Lablab
22CP22200M(200-800)+++–++++++Mono on PAGE
23CP23200S (200)++++++++++Mono on PAGE
24CP24200M(300-1000)+–+–++++––U*
25CP25250S (250)––––+–+––+Mono on PAGE
26CP26––––––––––––No amp in Lablab
27CP27200–––––––––––No amp in Lablab
28CP28200–––––––––––No amp in Lablab
29CP29200S (200)+++++++ (InDel)+++Poly on PAGE
30CP30200M+–+–+++––+Mono on PAGE
31CP31200M+++–++++++Mono on PAGE
32CP32200S (200)++++++++++Mono on PAGE
33CP115150M––––++++++U*
34CP117300S (150)++++++++++Mono on PAGE
35CP163200–––––––––––No amp in Lablab
36CP171180S (220)++++++++++Mono on PAGE
37CP181280S (250)++++++++++Mono on PAGE
28CP197450M+++–++–+–+U*
29CP201200M++++++++++Mono on PAGE
40CP215200S (180)++++++++++Mono on PAGE
41CP239180M+–––++++++U*
42CP333280M++––+++––+U*
43CP359250–––––––––––No amp in Lablab
44CP391200S (200)–+––+–+––+Mono on PAGE
45CP395100S (100)–++–+++––+Mono on PAGE
46CP397––––––––––––No amp in Lablab
47CP403150S (150)++++++++++Mono on PAGE
48CP431300S (250)++++++++++Mono on PAGE
49CP433280M++++++++++Mono on PAGE
50CP435200S (170)++++++++ (InDel)++Poly on PAGE
51CP443220S (350)––+–+++––+Mono on PAGE
52CP573100M––+––+++–+U*
53CP605300––––––––––+No amp in Lablab
54Y1300––––––––––+No amp in Lablab
55Y21300––––––––––+No amp in Lablab
56Y26300––––––––––+No amp in Lablab
57Y31350S (280)++++++++++Mono on PAGE
58Y45100S (120)++++++++++Mono on PAGE
  U* : these are not used for sequencing and those primers needs optimization for PCR conditions
**1:GL48, 2:GL147, 3:GL153, 4:HA4, 5:Rongai, 6: Highworth, 7:CPI24973, 8:CPI31113, 9:CPI60216 all are Lablab, 10:Cowpea Note: + means amplification positive and – means amplification negative        S: single band, D: double band & M: multiple band

Identification of SNPs or InDels in genic fragments through sequencing

Due to low lack of polymorphism in genic fragments EST-SSRs, we followed targeted amplicon sequencing to develop novel EST-SNPs/InDels based markers. Total 23 genic fragments were sequenced for 9 Lablab genotypes, of which 18 represented good quality sequence reads.  Through multiple sequence analysis of all these sequences, we identified total 59 SNPs and 16 InDels in the analysed sequences (Table 6). The details of sequence variations observed for each primer were shown in Table 7.

Table 6. Sequencing of genic fragments and identification of SNPs/InDels

Sl. No.Genic fragmentsAmplicon sizeSNPsInDelsRemarks
1CP222051Both SNPs & InDel
2CP53003–Only SNPs
3CP8200–2Only InDel
4CP15200––Not good sequence
5CP162502–Only SNPs
6CP23200––Not good sequence
7CP322001–Only SNPs
8CP117150––Not good sequence
9CP1712201–Only SNPs
10CP18125021SNPs
11CP215180–1SNPs
12CP4031501–Only SNPs
13CP4312502–Only SNPs
14CP4351701–Only SNPs
15Y13001–Only SNPs
16pDLL200––Not good sequence
175S rRNA30031Both SNPs & InDels
18fril300––Not good sequence
19Met11000154Both SNPs & InDels
20Met2800155Both SNPs & InDels
21AF 1519614002–Only SNPs
22AF 2872584003–Only SNPs
23D 1355780021Both SNPs & InDels
  Total5916 

Table 7. Details of SNP and InDel variations observed in different genic fragments of Lablab bean genotypes

                                                                                                 Met1
Genotype12345678910111213141516171819
CPI24973CCTCCCGAATTACGTGGCA
CPI31113CTTCCTAAACTACA––GTT
CPI60216No sequence
RongaiTC––CCGATTAGTA––ACA
HighworthTC––GCGGATAGCA––GCA
HA-4TC––CCGATTAGTA––ACA
GL48TC––CCGATTAGTA––ACA
GL147TC––CCGATTAGTA––ACA
GL153TC––CCGATTAGTA––ACA
Met2
  Genotype1234567891011121314151617181920
CPI24973TCTTTGGTTATCGG–GATCTGCAGTG
CPI31113TCTTTGGTTATTAG–TG—-CTATT
CPI60216CGC—–—TATATGTATCTGGTATT
RongaiTCTTTGGTTATTAG–GATCTGGAGAT
HighworthTCTTTGGTTATTAG–GATCTGGAGAT
HA-4TCTTTGGTTATTAG–GATCTGGAGAT
GL48TCTTTGGTTATTAG–GATCTGGAGAT
GL147TCTTTGGTTATTAG–GATCTGGAGAT
GL153TCTTTGGTTATTAG–GATCTGGAGAT
 D13557AF287258AF1519615S rRNA
  Genotype1234123121234
CPI24973TT————-AATACA–TGA
CPI31113CAAGCTCAACGTATAGTCGTANo sequence
CPI60216     No sequenceTCGCANo sequence
RongaiCAAGCTCAACGTATAATTACACTGT
Highworth     No sequenceTTACACGAT
HA-4CAAGCTCAACGTATAATTACGCTGT
GL48CAAGCTCAACGTATAATTACANo sequence
GL147CAAGCTCAACGTATAATTACACTGT
GL153CAAGCTCAACGTATAATTACACTGT
 CP2CP5CP8CP16
Genotype12345671231212
CPI24973TGGGCAAGAAGAGCTTGTT————AC
CPI31113CTCTA– – – – – – – –TCTA—CTTACTTCTTCTGC
CPI60216CTCTAAAGAAGAGTCTA—————GT
RongaiCTCTAAAGAAGAGTCGA—————AC
HighworthCTCTAAAGAAGAGTCGA—————AC
HA-4CTCTAAAGAAGAGTCGA—————AC
GL48CTCTAAAGAAGAGTCGA—————AC
GL147CTCTAAAGAAGAGTCGA—————AC
GL153CTCTAAAGAAGAGTCGA—————AC
CP32CP215CP431CP171CP403CP435CP181Y31 
Genotype11121111231 
CPI24973A–AGCTGTTCNo sequence 
CPI31113A–GGCCNo sequenceTTAG 
CPI60216A–ATGTTA–AG 
RongaiA–ATCTTTTAA 
HighworthACATCTTTTAA 
HA-4T–ATCTTTTAA 
GL48A–ATCTTTTAA 
GL147A–ATCTTNo sequenceA 
GL153A–ATCTT    T              T  A A

When we analysed genic fragment sequences, only SNPs were observed for nine primers such asAF 287258, AF151961, CP5, CP16, CP 431, CP171, CP 403, CP 435 and Y3.  Whereas, two primers namelyCP 215 and CP8 revealed only InDel variations. However, five primers viz., CP2, Met 1, Met 2, D13557 and CP181 showed both SNPs and InDels. The two primers namely Met 1 and Met2 showed the highest number of SNPs (15 each) and 4, 5 InDels across the genotypes respectively. In our study, InDel length ranged from single base to 13 bases, D 13557 and CP 8 showed 13 and 12 base InDels, respectively.  Overall sequencing results revealed 59 SNPs and 16 InDels from 18 genic fragments among nine parental genotypes. Interestingly we observed more SNPs than INDELs. The SNP/INDEL variation could be synonymous or non-synonymous variation. The low SNP variation among the Indian Lablab reveals homology and high level of sequence conservation of these genes in this set of genotypes. The higher sequence variations identified between the Indian and African lablab genotypes indicated low homology between the two groups. Further, the identified SNPs and Indels of genic fragments of primers viz., Met 2, AF 287258-1, AF 285278-2, AF 151961, D 13557, CP 5, CP16 and CP 431, were then used to develop 8 allele-specific markers.

Validation of SNP/InDel markers through allele-specific PCR

Parental polymorphism study

A wide variety of different methods have been developed to carry out high throughput genotyping of SNPs using automated systems [22]. These methods are often reliant on expensive equipment and require high developmental costs. Such marker assays generated are not commonly transferable between laboratories due to differences in the assay techniques used. Therefore, a simple and cost effective method for SNP marker genotyping would greatly improve the marker transferability and application [23]. Towards this end, allele-specific PCR (ASPCR) is known to be an efficient and common approach for genotyping SNP markers. This has enabled the detection of heterozygotes in a single assay using four primers in the same PCR mix that involved tetra primer PCR [24,15]. A simplified approach using three primers has been used [14].

In the present investigation, we tried to deploy both tri-primer and tetra-primer AS-PCR methods. Compared to tri- method, the tetra-primer method was found successful in distinguishing the heterozygous SNP alleles (Fig.1b). Seven out of eight allele-specific primer pairs viz., Met 2, AF 287258-1 AF 285278-2, AF 151961, D 13557, CP 5, CP16 and CP 431 could distinguish the two different alleles in HA 4, CPI 31113 or CPI 60216, respectively. One primer (CP 5) failed to distinguish heterozygous alleles although it was successfully amplified between the parents (Table 8). The possible reason may be that many of the internal primers designed for the ASPCR amplifications had suboptimal qualities for PCR based on the position of the SNP site while designing of primers likely resulting in amplification failure. Whereas, compared to internal primers flanking-primers always have a best choice made from many possibilities during primer designing.  In tetra primer ARMS-PCR method inner primers encompass a deliberate mismatch at position -2 from the 3’ terminus, because an extra mismatch found to increase the specificity of classical ARMS [25]. Similarly, robustness and reproducibility of the AS-PCR approach against primer extension using tri-primer methods in single reaction was also tested to show the specificity [14].

  1.                                                                                 b)

Fig.1 a) Comparison of EST-SSR primer CP2 profile on 10 lablab genotypes using on 2% agarose gel and  5% PAGE b)Allelic differences as observed on three mapping parents CPI 31113, HA 4 and CPI 60216 using  allele specific primer AF 287258 based on tetra primer method (Where, L= 50bp ladder)

Table 8. Amplification pattern for allele specific primers in parental lines

Sl No.Primer nameAmplicon size in base pairsRemarks
Common bandAllele specific band
HA 4CPI 31113CPI 60216
1.Met 2400250150NACo-dominant for HA4 X CPI31113 Dominant for HA4 X CPI60216
2.AF 287258-1330230130130Co-dominant for both crosses
3.AF 287258-2230160100100Co-dominant for both crosses
4.AF 151961200100130NACo-dominant for HA4 X CPI31113 Dominant for HA4 X CPI60216
5.D 13557600400200NACo-dominant for HA4 X CPI31113 Dominant for HA4 X CPI60216
6.CP5300150150150Difficult to assay
7.CP16240150120120Co-dominant for both crosses
8.CP431300120180NACo-dominant for HA4 X CPI31113 Dominant for HA4 X CPI60216

The results of the present investigations indicated that the method utilized here could be broadly applicable to the development of SNP markers, where there is sufficient knowledge available on DNA sequence around the SNP sites. AS-PCR has enabled to develop informative markers that are polymorphic and can be used to map the transcriptome, for general linkage mapping for QTL detection, as perfect markers for the candidate gene approach, for varietal identification and to perform the function of DNA markers in general. These markers could act as an adjunct to CAPS where sites are not sensitive to restriction enzyme assay or as a more reliable replacement. In particular, they will be useful for projects that are on a modest budget or where sophisticated equipment is not available.

Genotyping of mapping populations

The choice of DNA markers used for mapping may depend on the availability of characterized markers or the appropriateness of particular markers for a particular species. Once polymorphic markers have been identified, they must be screened across the entire mapping population, including the parents. In this study, we validated 7 polymorphic markers across segregation lines of two F2 mapping populations derived from the crosses HA4 × CPI31113-80F2 and HA4 × CPI60216- 89 F2 individuals respectively (Table 9, Fig.2).  Marker segregation patterns were examined to test Mendelian 1:2:1 segregation ratios in F2 populations. As a result 6 out of 7 markers exhibited 1:2:1 ratio in HA4 X CPI 31113 population. However, only three markers CP5- SNP, AF 287258 and AF 151961 could amplify and show 1:2:1 ratio in HA4 X CPI 60216 population. These results suggested the novel SNP and InDel markers developed here through sequencing of genic fragments are highly useful for construction of genetic maps and trait mapping in dolichos bean. Similarly, RFLP markers were deployed  in Lablab purpureus L. (Sweet) to show expected segregation ratios of 1:2:1 in F2 mapping population [26].

Fig. 2 Genotyping of 89F2segregating individuals of mapping population HA4 X CPI 60216 using AF 287258

          allele specific primer (Where, L= 50bp ladder, P1: HA4, P2: CPI 60216)

Table 9. Segregation patterns of allele specific markers in two F2 populations

Sl. NoMarkersHA4 X CPI 31113HA4 X CPI 60216
P1 (A)P2 (B)Heterozygotes (H)RatioP1  (A)P2 (B)Heterozygotes (H)Ratio
1.CP5 – SNP1717311:2:12126401:2:1
2.CP2 – indel1920391:2:1––– 
3.CP8 – indel1819351:2:1––– 
4.Met IV – indel1716291:2:1––– 
5.AF 287258 – allele specific2019391:2:12221441:2:1
6.D13557 – allele specific1820401:2:1––– 
7.AF 151961 – allele specific––– 2123431:2:1

Conclusion

The amplification of cowpea genic SSR primers in Lablab beanshowed high marker transferability rate. The sequencing of 18 genic fragments among nine parental genotypes, revealed 59 SNPs and 16 InDels. Using SNPs and InDels information’s we successfully developed eight allele specific SNP and InDel markers. Finally, validated these markers through parental polymorphism study followed by genotyping of two F2 populations, and confirmed the immediate utility of such markers for trait mapping in Dolichos bean.

Acknowledgements 

The authors are highly grateful to the Kirkhouse Trust, UK for extending financial support.

References

  1. Fuller, D.Q., 2003. African crops in prehistoric South Asia: a critical review. In: Neumann, K., Butler, A., Kahlheber, S. (Eds.), Food, Fuel, fields – Progress in African Archaeobotany, Heinrich-Barth-Institut, 15. Africa Praehistorica, Koln, Germany, pp. 239 –271.
  2. Khatun, R., Uddin M.I., Uddin, M.M., Howlader, M,T,H. and Haque, M, S., 2022. Analysis of qualitative and quantitative morphological traits related to yield in country bean (Lablab purpureus L. sweet) genotypes. Heliyon 8:e11631.doi.org/10.1016/j.heliyon.2022.e11631.
  3. Letting, F.K., Venkataramana, P.B and Ndakidemi, P.A. 2022. Pre-breeding prospects of Lablab (Lablab purpureus L. Sweet) accessions in Tanzania: Morphological characterization and genetic diversity analysis. Agronomy 12:2272. https://doi.org/ 10.3390/agronomy12102272.
  4. Adnan, M.A., Raffi, S.A., Rubel, M.H., Noor, M.M.A., Rahman, A.B., Akhter, B., Raiza, S. and Haque, M.A. 2021. Screening of lablab bean genotypes for higher grain yield and resistance against bean common mosaic virus. SABRAO J. Breed. Genetics 53: 57-69.
  5. Murphy, A. M. and Colucci, P. E. 1999.  A tropical forage solution to poor quality ruminant diets: A review of Lablab purpureus. Livestock Research for Rural Development, 11:96-113.
  6. Liu, C. J. 1996. Genetic diversity and relationships among Lablab purpureus genotypes evaluated using RAPD markers. Euphytica 90: 115-119.
  7. Maass, B. L. 2005. Changes in seed morphology, dormancy and germination from wild to cultivated hyacinth bean germplasm (Lablab purpureus L.  Papilinoideae). Genetic Reso. Crop Evol., 52: 1-9.
  8. Venkatesha, S. C., Byregowda, M., Mahadevu, P., Mohanrao, A., Kim, D. J., Ellis, T. H. N. and Knox, M. R., 2007, Genetic diversity within Lablab purpureus and the application of gene specific markers from a range of legume species. Plant Genet. Res., 5 (3): 154-171.
  9. Zhu, H., Kim, D. J., Baek, J. M., Choi, H. K., Ellis, L. C., Kuester, H., Mccombie, W. R., peng, H. M. and Cook, D. R., 2003. Syntenic Relationships between Medicago truncatula and Arabidopsis reveal extensive divergence of genome organization, Plant Physiol., 131: 1018-1026.
  10. Humphry, M. E., Konduri, V., Lambrides, C. P., Mangner, T., Meintrya, C. L., Aitjen, E. A. B. and Lin, C. J., 2002. Development of a mungbean (Vigna radiate) RFLP linkage map and its comparison with lablab (Lablab purpureus L.) reveals a high level of colinearity between the two genomes. Theor. Appl. Genet., 105: 106-166.
  11. Ellis, T.H.N., Davies, D.R., Castleton, J.A. and Bedford, I.D., 1984. The organization and genetics of rDNA length variants in peas. Chromosoma 91: 74 –81.
  12. Patil, P. G., Byre Gowda, M., Kundur, P. J., Vimarsha, H. S. and Shashidar, H. 2015. Upgraded horizontal polyacrylamide gel units for DNA marker genotyping. Indian Journal of Science and Technology 8(9): 822-827.
  13. Hall, T.A. (1999) BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98.
  14. Soleimani, V. D., Baum, B. R. and Johnson, D. A. 2003. Efficient validation of single nucleotide polymorphisms in plants by allele-specific PCR, with an example from barley, Plant Mol. Biol. Reporter 21: 281-288.
  15. Ye, S., Dhillon, S., Ke, X., Collins, A. R. and Day, I. N. M., 2001. An efficient procedure for genotyping single nucleotide polymorphisms, Nuc. Acids Res., 29(17): e88.
  16. Young, N.D., Danesh, D, Menancio-Hautea, D. and Kumar, L. 1993. Mapping oligogenic resistance to powdery mildew in mungbean with RFLPs. Theor Appl Genet., 87: 243-249.
  17. Anderson, J., Churchill, G., Autrique, J., Tanksley, S. and Sorrells, M., 1993. Optimizing parental selection for genetic linkage maps. Genome 36: 181–186.
  18. Collard, B.C.Y., Pang, E.C.K., and Taylor, P.W.J., 2003. Selection of wild Cicer accessions for the generation of mapping populations segregating for resistance to ascochyta blight. Euphytica, 130: 1–9.
  19. Joshi, C. and Nguyen, H., 1993. RAPD (random amplified polymorphic DNA) analysis based inter varietal genetic relationships among hexaploid wheats. Plant Sci., 93: 95–103.
  20. Yu, L.X. and Nguyen, H., 1994. Genetic variation detected with RAPD markers among upland and lowland rice cultivars (Oryza sativa L.). Theor. Appl. Genet., 87: 668- 672.
  21. Wang, M.L., Gillaspie, A.G., Newman, M.L., Dean, R.E, Pittman, R.N, Morris, J.B. and Pederson, G.A. 2004. Transfer of simple sequence repeat (SSR) markers across the legume family for germplasm characterization and evaluation. Plant Genetic Resources 2: 107-119.
  22. Gupta, P. K., Roy, J. K. and Prasad, M., 2001. Single nucleotide polymorphisms: A new paradigm for molecular marker technology and DNA polymorphism detection with emphasis on their use in plants. Curr. Sci., 80(4): 524-535.
  23. Kwok P-Y, Chen X. 1998. Detection of single nucleotide polymorphisms. In Genetic Engineering, Principles and Methods, ed. JK Setlow. New York: Plenum. 20:125.
  24. Ye, S., Humphries, S. and Green, F., 1992. Allele specific amplification by tetraprimer PCR, Nuc. Acids Res., 20 (5): 1152.
  25. Little, S. 1997. ARMS analysis of point mutations. In Taylor, G.R. (ed.) Laboratory Methods for detection of mutations and polymorphisms in DNA. CRC Press, Boca Raton, FL, pp.45-51
  26. Konduri, V., Godwin, I. D. and Liu, C. J., 2000. Genetic mapping of the Lablab purpureus genome suggests the presence of ‘cuckoo’ gene(s) in this species, Theor. Appl. Genet., 100: 866–871.

Similar Posts