<?xml version="1.0" encoding="UTF-8"?><rss version="2.0"
        xmlns:content="http://purl.org/rss/1.0/modules/content/"
        xmlns:wfw="http://wellformedweb.org/CommentAPI/"
        xmlns:dc="http://purl.org/dc/elements/1.1/"
        xmlns:atom="http://www.w3.org/2005/Atom"
        xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
        xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
        >
<channel>
        <title>Theoretical Biology Forum - Feed</title>
        <atom:link href="https://tbf.peerjournals.net/thermotolerance-acquisition-in-native-chicken-and-its-crosses-by-early-thermal-conditioning-through-expression-of-heat-shock/?view=xml-feed" rel="self" type="application/rss+xml" />
        <link>https://tbf.peerjournals.net</link>
        <description>Peerjournals</description>
        <lastBuildDate>Mon, 25 May 2026 05:41:34 +0000</lastBuildDate>
        <language></language>
        <sy:updatePeriod>hourly</sy:updatePeriod>
        <sy:updateFrequency>1</sy:updateFrequency>
        <generator>https://wordpress.org/?v=6.0.9</generator>

<image>
	<url>https://tbf.peerjournals.net/wp-content/uploads/2022/10/cropped-TBF-LOGO-32x32.png</url>
	<title>Thermotolerance Acquisition in Native Chicken and its Crosses by Early Thermal Conditioning Through Expression of Heat Shock &#8211; Theoretical Biology Forum</title>
	<link>https://tbf.peerjournals.net</link>
	<width>32</width>
	<height>32</height>
</image> 
                        <item>
                        <title>Thermotolerance Acquisition in Native Chicken and its Crosses by Early Thermal Conditioning Through Expression of Heat Shock</title>
                        <link>https://tbf.peerjournals.net/thermotolerance-acquisition-in-native-chicken-and-its-crosses-by-early-thermal-conditioning-through-expression-of-heat-shock/</link>
                        <pubDate>Sat, 08 Jul 2023 10:58:57 +0000</pubDate>
                        <dc:creator>admin</dc:creator>
                        <authors>
                                                        <author>
                                <name>Varun A</name>
                                <affiliationId>1*</affiliationId>
                                </author>
                                                            <author>
                                <name>Omprakash A.V</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Kumanan K</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Vairamuthu S</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Ezhilvalavan S</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Karthikeyan N</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Vijayarani K</name>
                                <affiliationId>2</affiliationId>
                                </author>
                                                            <author>
                                <name>Nithya Quintoil</name>
                                <affiliationId>1</affiliationId>
                                </author>
                                                    

</authors>
                        <guid isPermaLink="false">http://tbf.peerjournals.net/?p=1846</guid>
                        <abstract language="eng"><p>The present experiment was conducted to study the effect of thermal conditioning on liver HSPs mRNA expression and serum T3 levels in native chicken Aseel (ASL), Naked Neck (NN), and it&#8217;s cross variety Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) under  heat stress. Chicks from four varieties (ASL, ARW, NN, NNB3) were divided into control (C) and heat-exposed (H) groups. The control chicks (C) were reared in at ambient temperature (28±1°C). H group chicks were heat stressed at 39±1º C for 2 hours daily during 0-2 weeks and 5-6 weeks of age. In 12th week, the control group (C) was divided into two groups i.e., unexposed control (C) and control exposed (CE). Birds from H (HE) group and the CE group were thermal challenged 39±1°C for 4 hours daily on the 12th week. On 14th, 42nd, and 84th day, serum was collected and processed for Triiodothyronine (T3) by Radioimmuno assay kit. The Cloacal temperature and T3 concentration were significantly (p<0.01) high and low in the H group, irrespective of varieties at 14th and 42nd d. On the 84th d birds from each group were sacrificed and liver samples were collected for further processing. On 84th day the relative mRNA expression (fold change) of all four HSP genes (HSP 20, 60, 70, and 90) were significantly (P<0.01) high in HE and CE groups in all four varieties. CE (suddenly exposed) group birds, not exposed to high temperature during early age had significantly (P<0.01) high mRNA expression, while pre-conditioned birds (HE) had significantly (P<0.05) low gene expression. From the present study, it can be concluded that the thermal conditioning of chicks during early age had a positive effect and improves the thermo tolerance in the later part as revealed by the low expression of the HSPs gene, temperature, and improved T3 levels as stress indicators in native chickens and its cross varieties.
</p>
</abstract>
                        <fullTextUrl format="html">https://tbf.peerjournals.net/thermotolerance-acquisition-in-native-chicken-and-its-crosses-by-early-thermal-conditioning-through-expression-of-heat-shock/</fullTextUrl>
                        <fullhtmlContent><![CDATA[
<p><strong>Introduction</strong></p>



<p>In the poultry industry, heat stress is one of the major causes for mortality with negative effects on the production and welfare of poultry[1]. Temperature is one of the critical factors that exerts a negative influence on the performance of poultry and causes huge losses in terms of loss of productivity, reduced growth rate, feed efficiency, egg shell quality, survivability, reduced reproductive efficiency, reduced immune competence and increased investment costs to mitigate the effects of temperature-induced climate change [2,3]. Temperature beyond the thermal neutral zone (18-24°C) due to climatic change and another factor that leads to cascading effects on thermoregulation and could be lethal to the birds as birds are more vulnerable to high temperature.</p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Heat shock proteins (HSPs) were a set of proteins synthesized in response to physical, chemical<ins>,</ins> or biological stresses including heat exposure [4],which effectively protects several proteins and cell organelles from stressors. HSPs are broadly classified into six distinct families based on their molecular weights ranging from 10 to 150 kDa [5]. Changes in HSP<del>s</del> expression can be detected during heat stress in various vital organs <em>viz</em>, heart, liver<ins>,</ins> and kidneys can be correlated with thermal tolerance degree in living organisms.</p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; The genetic selection of birds for thermo tolerance is a big challenge in global poultry production. In tropical and sub-tropical countries, the ventilation systems in poultry houses are not fully functional due to high environmental humidity. In the present day, crossbreeding between indigenous breeds is one of the most popular breeding methods for obtaining a commercial hybrid resistant to tropical weather conditions with the potential of producing a reasonable amount of eggs and meat [6]. The genetic control of heat tolerance is complex and has low heritability. Few indigenous chickens and very few exotic breeds<del>,</del> have adequate heat tolerance [7]. The introgression of genes from thermo-tolerant strains into grand parental stock is an effective strategy applied to create the genetic progress of commercial strains that can tolerate heat stress. The genes associated with heat tolerance have been investigated in chickens, including the naked-neck, frizzle<ins>,</ins><ins><del>,</del></ins> and dwarfism [8],and slow/rapid featheringgenes [9]. Aseel is one of the native chickens, which is hardy in nature and had considerable heat tolerance potential. Hence, the present study was conducted to evaluate the effects of thermal conditioning on liver HSP 90, 70, 60<ins>,</ins><ins><del>,</del></ins> and 20 mRNA expression and serum T<sub>3</sub> levels in native chicken Aseel (ASL), Naked Neck (NN) and its cross variety such as<del>,</del> Aseel x Nandanam chicken-4 (ARW)<ins>,</ins> and Naked neck x Nandanam broiler-3 (NNB3), under heat-induced stress conditions.</p>



<p><strong>Material and Methods</strong></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; The experiment was conducted at Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India. The experimental design and work were<ins> </ins>approved by the <strong>Institutional Animal Ethics Committee (</strong><strong>IAEC; Approval No.30/SA/IAEC/2017)</strong>. The native chicken Aseel (ASL), Naked neck (NN)<ins>,</ins><ins><del>,</del></ins> and the cross varieties were developed by introducing NN birds into <ins>the </ins>Nandanam broiler-3 (NNB3) and the Aseel birds into the<ins> </ins>Nandanam chicken-4 (ARW) population to observe the effect of thermal conditioning of chicks on the expression of HSP genes in liver tissue. Nandanam broiler-3 and Nandanam chicken-4 were synthetic broiler<ins>s</ins><ins><del>s</del></ins> and layer varieties<ins> </ins>developed by Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India.</p>



<p><strong>Experimental chicks and procedure. </strong>A total of 1120 chickens <em>i.e.</em> 280 numbers of each variety with straight-run chicks were used in the study. All four varieties were obtained from the Poultry Research Station, Tamil Nadu Veterinary and Animal Sciences University, India. Chicks from four varieties (ASL, ARW, NN, NNB3) were divided in<del> </del>to control (C) and heat-exposed (H) groups. The heat stress conditions applied in the present study attempted to mimic the natural environment conditions of tropical regions, where temperatures increase with the intensity of daylight. Relative humidity was not artificially controlled. The C chicks were reared <del>in <ins>at</ins></del><ins>at</ins><ins> </ins>ambient temperature (28±1°C). H group chicks were exposed to 39±1º C for 2 hours daily during 0-2 weeks and 5-6 weeks of age, in the thermal chamber using thermostat-controlled equipment. Chicks from the H (HE – Heat exposed) group and a sample of chicks from<ins> </ins><ins>the</ins><ins> </ins>control group (CE – Control exposed) were exposed to 39±1°C for 4 hours daily on the<ins> </ins>12<sup>th</sup> week of age. At the end of thermal conditioning and thermal challenge cloacal temperature was recorded.</p>



<p><strong>Sample collection. </strong>At the end of the14<sup>th</sup> and 42<sup>nd</sup> d blood samples were collected from six birds of each group from the brachial vein (wing vein). Serum was separated by centrifuging at 2000 rpm for 10 minutes and used for T<sub>3</sub> estimation. Six birds from each group were sacrificed on 84<sup>th</sup> d and liver tissue was collected and stored with RNA later at -20º C for further use.</p>



<p><strong>Triiodothyronine (T<sub>3</sub>) estimation. </strong>T<sub>3</sub> levels in serum samples were estimated using the Radioimmuno assay kit (Immunotech, Czech Republic). The antibody-coated tubes were added with 25 µl of calibrators to the standard tubes labelled as 0, 0.75, 1.5, 3.0, 6.0<ins><del>,</del></ins><ins>,</ins> and 12.0 nmol<ins>,</ins> and control sera containing <ins><del>a</del></ins><ins>a</ins><ins> </ins>known level of triiodothyronine and unknown<ins> </ins>samples were taken in duplicate. <sup>125</sup>i-labeled triiodothyronine tracer (200 µl) was added to all the tubes and mixed well. The tubes were incubated at 20˚C for 1 hour in <ins><del>an </del></ins>an orbital shaker. The contents have<ins> </ins>aspired carefully. The radioactivity of the tubes was counted for 1 min in the<ins> </ins>gamma counter (Stratec, Germany). 200 µl of tracer was added to 2 additional tubes and the radioactivity was measured using a<ins> </ins>gamma counter to obtain total counts per minute. The hormone level was expressed in ng/dl.</p>



<p><strong>RNA extraction. </strong>Total RNA was extracted from liver samples using TRIzol™ (Invitrogen, California, USA) according to the manufacturer’s instructions. The quantity and quality of the extracted RNA were confirmed by spectrophotometry (NanoDrop ND-1000); the quantity was measured in ng/μl, and the purity was determined based on the A260/A280 and A260/A230 ratios. <strong>cDNA synthesis: </strong>RNA (1000 ng) from liver samples was<ins> </ins>reverse transcribed with the Prime Script First Strand cDNA Synthesis Kit (Takara, Japan) according to the manufacturer’s instructions using a mix of random hexamers and oligo-dT primers.</p>



<p><strong>Primers</strong>. Custom-synthesized oligonucleotides were procured from Eurofins Genomics. Details of primer sequences for genes with their annealing temperatures were presented (Table 1). <ins></ins></p>



<p><strong>Table 1.&nbsp; List of oligonucleotide primers for Real-time PCR</strong></p>



<figure class="wp-block-table"><table><tbody><tr><td><strong>Genes</strong><strong></strong></td><td><strong>Sequence (5′–3′)</strong><strong></strong></td><td><strong>Product Size (bp)</strong></td><td><strong>Annealing Temperature (ºC)</strong></td></tr><tr><td>Hsp90</td><td>F-GCATTCTCAGTTCATTGGCTACC R-CTGTCTTCTCCTCCTTCTCCTCT</td><td>&nbsp; 122</td><td>64</td></tr><tr><td>Hsp70</td><td>F-ATGAGCACAAGCAGAAAGAG R-TCCCTGGTACAGTTTTGTGA</td><td>95</td><td>59</td></tr><tr><td>Hsp60</td><td>F-AGAAGAAGGACAGAGTTACC R-GCGTCTAATGCTGGAATG</td><td>&nbsp; 116</td><td>64</td></tr><tr><td>Hsp20</td><td>F-GCGACCAGCCAGGAAGAAGAA R- GGGTCCGTGCTGTGCTTTGA</td><td>126</td><td>64</td></tr><tr><td>β-actin</td><td>F-GAG AAA TTG TGC GTG ACA TCA R-CCT GAA CCT CTC ATT GCC A</td><td>152</td><td>62</td></tr></tbody></table></figure>



<p><strong>Quantitative Real time Polymerase Chain Reaction</strong><strong>. </strong>The relative expression of specific gene mRNA was quantified by <ins><del>a </del></ins><ins>a </ins>real-time PCR detection system (Applied Biosystems Thermal Cycler &#8211; 96 plate). A total volume of 10 µl reaction mixture was prepared with 5 µl of 2X SYBR Green Premix Ex Taq (Takara, USA), 0.5 µl of forward and reverse primer each (5 picomoles concentration), 1.0 µl of complementary DNA and nuclease-free water. The qRT-PCR thermal cycler conditions were set at initial denaturation at 94<sup>o</sup>C for 5 min followed by 40 cycles of denaturation at 94<sup>o</sup>C for 10 s, annealing (* as indicated in Table 5) and extension at 72<sup>o</sup>C for 30 s, subsequent melting curve standards was performed to melt primer dimers by heating from 65<sup>o</sup>C to 95<sup>o</sup>C for 10s. All the samples were run in duplicate with no template control (NTC) included in each PCR reaction for all the genes to check the DNA contamination. The melting curve for each of the target<ins><del>s</del></ins><ins>s</ins> was checked to ascertain specific amplification before the cycle threshold cycle (Ct) values were recorded. The Ct values of the HSP 90, 70, 60<ins>,</ins> and 20 mRNA in samples were subtracted with the corresponding Ct value of the β-actin to obtain the DCt values. This DCt value of the sample from the treatment group was subtracted from<ins> </ins>DCt value of the control sample to obtain DDCt values. The results of the HSP70 mRNA expression levels were expressed as fold change (2<sup>&#8211;</sup><sup>DD</sup><sup>Ct</sup>) over the control<ins> [10].</ins></p>



<p><strong>Statistical Analysis. </strong>The data obtained on various parameters were statistically analyzed<ins> </ins>as per the method of Snedecor and Cochran<ins> [11]</ins><ins> </ins>using <ins><del>the </del></ins><ins>the </ins>computerized software program<del>me</del> SPSS Version 20.0 and post hoc analysis <ins>was</ins><ins> </ins>carried out using Duncan’s for<del> </del>&nbsp;multiple comparisons. <ins>One-</ins>way Analysis of Variance (ANOVA) and Independent <ins>T-test</ins> were used to compare means between the groups. Statistical analyses were completed with GraphPad Prism 7 (La Jolla, CA).</p>



<p><strong>Results</strong></p>



<p><strong>Cloacal temperature</strong></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; The Cloacal temperature was significantly (p&lt;0.01) higher in <ins>the </ins>H group, irrespective of varieties at on the 14<sup>th</sup> and 42<sup>nd</sup> day<ins><del>s</del></ins><ins>s</ins>. Among the variety, ARW and NN had <ins><del>the </del></ins><ins>the </ins>higher temperature <ins>on the</ins><ins> </ins>14<sup>th</sup> day, whereas NN and NNB3 had <ins>the </ins>higher temperature at the 42<sup>nd</sup> day (Table 2). The Cloacal temperature in the HE group was significantly (p&lt;0.01) lower than CE and significantly (p&lt;0.01) higher than C group on <ins>the </ins>84<sup>th</sup> day in all four <ins>varieties</ins><ins> </ins>(Table 3). Among the varieties, NN had <ins><del>a </del></ins><ins>a </ins>significantly high temperature. The present findings with respect to cloacal temperature in Naked neck strain was were<ins> </ins>in agreement with the result of Amrutkar <ins>[12]</ins> observed an increased cloacal temperature in heat-stressed CARIBRO-<del>T</del>ropicana (Naked neck gene bearing) birds when compared to control bird<ins>s</ins>. Whereas the present findings were in disagreement with the result of Gunal [13]<ins> </ins>who reported that there was a significantly decreased cloacal temperature (42.11<sup>o </sup>C) in the <ins>heat-</ins>exposed groups when compared with <ins><del>the </del></ins><ins>the </ins>unexposed control (42.34<sup>o </sup>C) group.</p>



<p><strong>Table 2. The cloacal<ins> </ins>temperature of </strong><strong>Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW)<ins>,</ins> and Naked neck x Nandanam broiler-3 (NNB3) at thermal conditioning on 14 and 42<sup>nd</sup> d of age</strong></p>



<figure class="wp-block-table"><table><tbody><tr><td><br>Variety</td><td><strong>Cloacal Temperature (</strong><sup>o</sup>C)</td></tr><tr><td><strong>14<sup>th</sup> day</strong></td><td><strong>42<sup>nd</sup> day</strong></td></tr><tr><td><strong>C</strong></td><td><strong>H</strong></td><td><strong>t value</strong></td><td><strong>C</strong></td><td><strong>H</strong></td><td><strong>t value</strong></td></tr><tr><td>Aseel</td><td>39.97<sup>bB</sup>±0.13</td><td>41.18<sup>bA</sup>±0.12</td><td>7.83<strong><sup>**</sup></strong></td><td>40.48<sup>B</sup>±0.15</td><td>41.96<sup>bA</sup>±0.35</td><td>5.27<strong><sup>**</sup></strong></td></tr><tr><td>ARW</td><td>40.25<sup>abB</sup>±0.14</td><td>41.69<sup>aA</sup>±0.09</td><td>7.93<strong><sup>**</sup></strong></td><td>40.68<sup>B</sup>±0.13</td><td>42.44<sup>abA</sup>±0.56</td><td>8.74<strong><sup>**</sup></strong></td></tr><tr><td>NN</td><td>40.49<sup>aB</sup>±0.15</td><td>41.65<sup>aA</sup>±0.05</td><td>6.14<strong><sup>**</sup></strong></td><td>40.91<sup>B</sup>±0.14</td><td>42.91<sup>aA</sup>±0.29</td><td>9.82<strong><sup>**</sup></strong>&nbsp;</td></tr><tr><td>NNB3</td><td>40.46<sup>aB</sup>±0.11</td><td>41.56<sup>aA</sup>±0.08</td><td>7.46<strong><sup>**</sup></strong></td><td>40.79<sup>B</sup>±0.15</td><td>42.89<sup>aA</sup>±0.28</td><td>8.17<strong><sup>**</sup></strong>&nbsp;</td></tr><tr><td>F value</td><td>3.36*</td><td>6.589**</td><td>&nbsp;</td><td>1.543<sup>NS</sup></td><td>6.808**</td><td></td></tr></tbody></table></figure>



<p><em>a, b Means with different superscripts in a column differ significantly within a variety</em></p>



<p><em>A,B Means with different superscripts in a row differ significantly within <ins><del>the </del></ins><ins>the </ins>treatment</em></p>



<p><em>NS-non Significant (p&gt;0.05), *-Significant (p&lt;0.05), ** Highly Significant (p&lt;0.01)</em></p>



<p><strong>Table 3. The cloacal<ins> </ins>temperature of </strong><strong>Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW)<ins>,</ins> and Naked neck x Nandanam broiler-3 (NNB3) at <ins>the </ins>thermal challenge on 84<sup>th</sup> d of age</strong></p>



<figure class="wp-block-table"><table><tbody><tr><td>&nbsp; Variety</td><td><strong>Cloacal Temperature (</strong><sup>o</sup>C) – 84<sup>th</sup> day</td></tr><tr><td><strong>C</strong><strong></strong></td><td><strong>HE</strong></td><td><strong>CE</strong></td><td><strong>F value</strong></td></tr><tr><td>Aseel</td><td>40.17<sup>bB</sup>±0.24</td><td>40.24<sup>bB</sup>±0.23</td><td>41.98<sup>bA</sup>±0.14</td><td>24.22**</td></tr><tr><td>ARW</td><td>40.39<sup>abC</sup>±0.18</td><td>41.35<sup>aB</sup>±0.21</td><td>42.04<sup>bA</sup>±0.19</td><td>18.22**</td></tr><tr><td>NN</td><td>41.13<sup>aC</sup>±0.24</td><td>41.33<sup>aB</sup>±0.25</td><td>42.88<sup>aA</sup>±0.22</td><td>16.06**&nbsp;</td></tr><tr><td>NNB3</td><td>40.99<sup>aC</sup>±0.31</td><td>41.19<sup>aB</sup>±0.25</td><td>42.48<sup>abA</sup>±0.24</td><td>9.01**</td></tr><tr><td>F value</td><td>3.475*&nbsp;</td><td>5.173*&nbsp;</td><td>4.2018*&nbsp;</td><td></td></tr></tbody></table></figure>



<p><em>a, b Means with different superscripts in a column differ significantly within a variety</em></p>



<p><em>A,B Means with different superscripts in a row differ significantly within <ins><del>the </del></ins><ins>the </ins>treatment</em></p>



<p><em>*-Significant (p&lt;0.05), ** Highly Significant (p&lt;0.01), (C- Control; CE- Control exposed; HE-Heat exposed)</em></p>



<p>Moreover, at <ins><del>a </del></ins><ins>a </ins>higher temperature, birds were unable to excrete the heat into <ins>the </ins>environment through evaporative losses which leads to more vigorous panting to excrete heat through evaporation which lead<ins>s</ins><ins><del>s</del></ins> to increased muscle movement during panting which increases the body temperature [14]. The results indicate that all <del>the </del>four strains were most affected at the first exposure of thermal stress. However<ins><del>,</del></ins><ins>,</ins> in subsequent stages of exposure, these birds indicate the sign of acclimatization by controlling their cloacal temperature toward<del>s</del> normal. The phenomenon of acclimatization under prolonged stress is <ins>well-</ins>documented in poultry and other animals. Among the variety, Aseel had <ins>the lower</ins> cloacal temperature at <ins>the </ins>thermal challenge. It shows the sign of adaptation or acclimatization towards thermal stress.</p>



<p><strong>Triiodothyronine (</strong><strong>T<sub>3</sub>) concentration</strong></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; On <ins>the </ins>14<sup>th</sup> and 42<sup>nd</sup> d, irrespective of all the four varieties, T<sub>3</sub> concentration was significantly (p&lt;0.01) lower in <ins>the </ins>H group when compared with <ins>the </ins>control (C) group (Table 4). Among the variety, ARW and NN had significantly (p&lt;0.05) lower T<sub>3</sub> concentrations on 14<sup>th</sup> and 42<sup>nd</sup> d, respectively. However in at 84<sup>th</sup> day CE group, sudden <ins>exposure</ins><ins> </ins>to high temperature for longer duration had significantly (p&lt;0.01) lower T<sub>3</sub> concentration, while the pre-exposed group (HE) had significantly higher T<sub>3</sub> concentration and <ins>was </ins>also comparable with <ins><del>the </del></ins><ins>the </ins>control (C) group (Table 5). Among the varieties, NN had <ins><del>a </del></ins><ins>a </ins>significantly lower T<sub>3</sub> concentration. Metabolism in birds during growth and production was regulated by thyroid hormone; therefore it is important in of chicks to heat stress. On <ins>the </ins>14<sup>th</sup> and 42<sup>nd</sup> day, the T<sub>3</sub> concentration was significantly lower in heat-exposed birds due to the stress condition immediately after exposure to high temperature. At 84<sup>th</sup> d, the T<sub>3</sub> concentration was significantly lower in the <ins><del>&nbsp;</del></ins>CE group indicating the stress condition of birds.<ins> </ins><del>&nbsp;&nbsp;</del>The T<sub>3</sub> concentration in HE group was significantly higher than CE and significantly lower than C group on 84<sup>th</sup> d in all <del>t</del>four varieties, indicating that those birds were adapted to higher temperature during re-exposure to heat stress.</p>



<p><strong>Table 4. T<sub>3</sub> concentration of </strong><strong>Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) at thermal conditioning on 14 and 42<sup>nd</sup> d of age</strong><strong></strong></p>



<figure class="wp-block-table"><table><tbody><tr><td><br>Variety</td><td><strong>Triiodothyronine (T3) (</strong>ng/dl<strong>)</strong></td></tr><tr><td><strong>14<sup>th</sup> day</strong></td><td><strong>42<sup>nd</sup> day</strong></td></tr><tr><td><strong>C</strong></td><td><strong>H</strong><strong></strong></td><td><strong>t value</strong></td><td><strong>C</strong></td><td><strong>H</strong><strong></strong></td><td><strong>t value</strong></td></tr><tr><td>Aseel</td><td>1.993<sup>A</sup>&nbsp;±0.009</td><td>1.730<sup>bB</sup>&nbsp;±0.026</td><td>9.16<strong><sup>**</sup></strong></td><td>2.093<sup>bA</sup>&nbsp;±0.008</td><td>1.963<sup>aB</sup>&nbsp;±0.009</td><td>5.68<strong><sup>**</sup></strong></td></tr><tr><td>ARW</td><td>2.017<sup>A</sup>&nbsp;±0.024</td><td>1.720<sup>bB</sup>&nbsp;±0.021</td><td>7.04<strong><sup>**</sup></strong>&nbsp;</td><td>2.117<sup>abA</sup>&nbsp;±0.018</td><td>1.873<sup>bB</sup>&nbsp;±0.018</td><td>9.16<strong><sup>**</sup></strong></td></tr><tr><td>NN</td><td>2.047<sup>A</sup>&nbsp;±0.021</td><td>1.787<sup>aB</sup>&nbsp;±0.021</td><td>8.22<strong><sup>**</sup></strong></td><td>2.163<sup>aA</sup>&nbsp;±0.009</td><td>1.793<sup>cB</sup>&nbsp;±0.022</td><td>6.46<strong><sup>**</sup></strong></td></tr><tr><td>NNB3</td><td>2.030<sup>A</sup>&nbsp;±0.006</td><td>1.793<sup>aB</sup>&nbsp;±0.029</td><td>6.81<strong><sup>**</sup></strong></td><td>2.157<sup>aA</sup>&nbsp;±0.024</td><td>1.823<sup>bcB</sup>&nbsp;±0.032</td><td>6.93<strong><sup>**</sup></strong></td></tr><tr><td>F value</td><td>1.845<sup>NS</sup></td><td>2.398*</td><td></td><td>4.107*&nbsp;</td><td>11.581**&nbsp;</td><td></td></tr></tbody></table></figure>



<p><em>a, b Means with different superscripts in a column differ significantly within a variety</em></p>



<p><em>A,B Means with different superscripts in a row differ significantly within <ins>the </ins>treatment</em></p>



<p><em>NS-non Significant (p&gt;0.05), *-Significant (p&lt;0.05), ** Highly Significant (p&lt;0.01)</em></p>



<p><strong>Table 5. T<sub>3</sub> concentration of </strong><strong>Aseel, Naked Neck (NN), Aseel x Nandanam chicken-4 (ARW) and Naked neck x Nandanam broiler-3 (NNB3) at thermal challenge on 84<sup>th</sup> d of age</strong></p>



<figure class="wp-block-table"><table><tbody><tr><td>Variety</td><td><strong>Triiodothyronine (T3) (n</strong><strong>g/dl</strong><strong>)</strong><strong> </strong><strong>– 84<sup>th</sup> day</strong><strong></strong></td></tr><tr><td><strong>C</strong><strong></strong></td><td><strong>HE</strong></td><td><strong>CE</strong></td><td><strong>F value</strong><strong></strong></td></tr><tr><td>Aseel</td><td>2.097<sup>bA</sup>&nbsp;± 0.024</td><td>1.987<sup>aB</sup>&nbsp;± 0.015</td><td>1.743<sup>aC</sup>&nbsp;± 0.012</td><td>105.08<strong>*</strong></td></tr><tr><td>ARW</td><td>2.127<sup>abA</sup>&nbsp;± 0.019</td><td>1.963<sup>abB</sup>&nbsp;± 0.009</td><td>1.693<sup>abC</sup>&nbsp;± 0.009</td><td>287.36<strong>**</strong></td></tr><tr><td>NN</td><td>2.173<sup>aA</sup>&nbsp;± 0.012</td><td>1.920<sup>bcB</sup>&nbsp;± 0.006</td><td>1.660<sup>bC</sup>&nbsp;± 0.015</td><td>480.76<strong>**</strong></td></tr><tr><td>NNB3</td><td>2.180<sup>aA</sup>&nbsp;± 0.015</td><td>1.950<sup>cB</sup>&nbsp;± 0.006</td><td>1.667<sup>abC</sup>&nbsp;± 0.027</td><td>196.17<strong>**</strong></td></tr><tr><td>F value</td><td>4.818*</td><td>8.708**</td><td>4.775*</td><td></td></tr></tbody></table></figure>



<p><em>a, b Means with different superscripts in a column differ significantly within a variety</em></p>



<p><em>A,B Means with different superscripts in a row differ significantly within <ins>the </ins>treatment</em></p>



<p><em>*-Significant (p&lt;0.05), ** Highly Significant (p&lt;0.01), (C- Control; CE- Control exposed; HE-Heat exposed)</em></p>



<p>The decreased feed intake, together with <del>a </del>decreased circulating thyroid hormone levels, resulted in lower metabolic and thermogenic rates, which <ins><del>is </del></ins><ins>is </ins>reflected by <ins><del>a </del></ins><ins>a </ins>decrease in animal production during exposure to stressful heat conditions<ins> [1</ins><ins>5</ins><ins>].</ins> The importance of thyroid hormones in adaptation to heat stress was related to the key role of this hormone in the regulation of metabolic rate in birds. Heat stress markedly depresses the activity of the thyrotrophic axis in birds which <ins><del>is </del></ins><ins>is </ins>reflected by <ins><del>a </del></ins><ins>a </ins>decrease in the plasma/serum T<sub>3</sub> concentration, resulting in functional hypothyroidism. <ins>Heat-</ins>conditioned birds had a significantly improve thermo tolerance. The improved thermotolerance was indicated by a significantly lower metabolic rate and significantly <ins>declining</ins><ins> </ins>T<sub>3</sub> levels <ins>[16]. </ins>Similar findings were reported<em><del>,</del></em> <ins>[3] </ins>in selected broiler chickens, pre-exposed to higher temperatures during incubation, which were attributed to <del>the </del>epigenetic adaptation. Significantly lower levels of T<sub>3</sub> concentration and lower metabolic rate <ins>were</ins><ins> </ins>observed in thermally conditioned chicken<ins> [17].</ins> The present findings with respect to decreased T<sub>3</sub> levels in <ins>the </ins>NNB3 broiler strain were in agreement with the findings of Vinoth <em>et al.<del>,</del></em> <ins>[18] </ins>reported that there were <del>&nbsp;</del>significantly decreased T<sub>3</sub> levels in the <ins>heat-</ins>exposed Punjab broiler-2 birds<del>,</del> when compared with control birds.</p>



<p><strong>HSP expression</strong></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; The mRNA expression of all <del>the </del>four HSP genes in <ins><del>the </del></ins>liver viz., HSP 90, 70, 60<ins><del>,</del></ins><ins>,</ins> and 20 were significantly (P&lt;0.01) higher in H group in all the four varieties (ASL, ARW, NN<ins><del>,</del></ins><ins>,</ins> and NNB3) when compared to control (C) birds. CE (<ins>suddenly </ins>exposed) group chicks, that were not exposed to high temperature during early age had significantly (P&lt;0.01) higher m RNA expression for all the HSP genes, while earlier exposed birds (HE) had significantly (P&lt;0.05) lower gene expression in all the four varieties on <ins>12<sup>th</sup>&#8211;</ins>week thermal challenge <em>i.e.,</em> re-exposure to high temperature on 84<sup>th</sup> day, indicating the lesser stress due to <ins>pre-</ins>adaptation (Fig. 1). Out of all HSP genes, HSP 70 is more expressive in all the four varieties followed by HSP 90, 60<ins>,</ins> and 20. Within <ins><del>a </del></ins><ins>a</ins><ins> </ins>variety, ASL and ARW had higher expression of HSP genes when compared to NN and NNB3. A strong<ins> </ins>positive correlation exists between body temperature and HSP synthesis which was also similar in the present study. The H group had significantly higher HSP levels immediately after exposure to high temperature due to <ins><del>&nbsp;</del></ins><ins>the </ins>increased stress condition of the birds in order to maintain the thermoregulatory mechanisms in the body on 14<sup>th</sup> and 42<sup>nd</sup> day. CE group chicks, which were not exposed to high temperature<ins>s</ins> during early age, had higher mRNA expression for all the HSP genes, while earlier exposed birds (HE) had lower gene expression in all<del> </del>four varieties on <ins><del>&nbsp;</del></ins><ins>the </ins>thermal challenge.</p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; When birds exposed to thermal stress, the synthesis of most proteins is delayed, but a group of highly conserved proteins known as heat shock proteins or heat stress proteins is rapidly synthesized<ins> [19]</ins> which helps in the survival of stressed cells and the stabilization of the internal environment. According to the molecular weights, HSP can be classified into 3 main families: HSP90 (~85-90 kDa), HSP70 (~68-73 kDa) and low molecular weight HSP (~16-47 kDa). Among the HSPs, HSP 70 is one of the most conserved and important protein families and has been extensively studied<ins> [20].</ins> The HSPs act as molecular <ins>chaperones </ins>that help in protein folding and assembly<ins>, and</ins><ins> </ins>assist in restoring the native state of <ins><del>the </del></ins><ins>the </ins>protein <ins>[21]. </ins>HSPs synthesis up-regulation under different stress conditions is an adaptive phenomenon resulting in improved thermo-tolerance. There exists a relationship between thermo-tolerance and HSPs synthesis in all living organisms. The liver<ins> </ins>is one of the high metabolically active organs and therefore, comparatively more susceptible to heat stress than other organs. Acute heat stress increased HSP90α, HSP90β, HSP70<ins>,</ins> and HSP60 expressions in broiler liver<ins> [22]</ins> <ins>[23]</ins> reported an<ins> </ins>increase HSP-70 expression in three chicken lines (Kampong, Arabic<ins>,</ins> and commercial) when exposed to acute heat stress (40˚C for 0, 0.5, 1.0<ins><del>,</del></ins><ins>,</ins> and 5h).</p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Pre-natal thermally manipulated <ins>colored</ins> broilers reared at high ambient temperature<ins><del>s</del></ins><ins>s</ins> had lower HSPs expressions in different tissues<ins> [3, 24].</ins> There exist<del>s</del> breed differences, Naked Neck chicken had no or variable effect of thermal manipulation (TM) in earlier reports.</p>



<figure class="wp-block-table"><table><tbody><tr><td><br><strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <img loading="lazy" width="296" height="232" src=""> <strong>A</strong></td><td><strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <img loading="lazy" width="280" height="232" src=""> <strong>B</strong></td></tr><tr><td><strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <img loading="lazy" width="304" height="264" src=""> <strong>C</strong></td><td><strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>c</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>b</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <strong>a</strong><strong>Heat shock protein (<em>HSP</em>) gene expression in liver of Naked neck (NN) chicks at 42</strong><strong>nd </strong><strong>day of age. (C- Control; CE- Control exposed;</strong><strong>HE- Heat exposed). A. HSP 90 alpha, B. HSP 70, C. HSP 60. </strong><strong>a, b </strong><strong>Means with different superscripts differ significantly (P&lt;0.05)</strong><strong></strong> &nbsp; <img loading="lazy" width="280" height="256" src=""> <strong>D</strong></td></tr></tbody></table></figure>



<p><strong>Figure 1. </strong><strong>Heat shock protein (<em>HSPs</em>) genes expression in liver sample at 84<sup>th</sup> d. (C- Control;<br>CE- Control exposed; HE- Heat exposed). A. ASL, B. ARW, C. NN, D. NNB3.<br>a,b,c Means with different superscripts differ significantly (P&lt;0.01)</strong></p>



<p>This may be due to lesser feather coverage in <ins>the</ins><ins> </ins>Naked Neck chicken that helped in dissipating excess body heat than the <ins>colored</ins> broiler. Heat conditioning of 5-7 <ins><del>d</del></ins><ins>ay-old</ins> chicks on <ins><del>the </del></ins><ins>the </ins>subsequent thermal challenge at 42<sup>nd</sup> day had decreased HSPs 27, 70<ins>,</ins> and 90 expressions in heart, liver and lung tissues<ins> [18]</ins><del>. </del>It is clear from these reports that TM during incubation or aearly age confers thermo tolerance during <ins>the </ins>later stage of life and this thermo tolerance is achieved through lowered body temperature during <ins>the </ins>stress period. Furthermore, lower HSPs levels in <ins>thermo-tolerance</ins> birds indicate lesser damage to the cellular structures. Pre-exposure to high temperature induces physiological memory due to epigenetic adaptation to high temperature resulting in improved thermo tolerance during <del>the </del>post-natal life<ins> [25].</ins></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; The birds on re-exposure to thermal stress on 84<sup>th</sup> day showed significantly lower HSP levels in HE group indicating the adaptation of birds to high temperature as a result of pre-conditioning. In <ins><del>the </del></ins><ins>the </ins>CE group, the HSP levels were significantly higher indicating the effect of thermal stress in the birds. This clearly substantiates the hypothesis of pre-thermal conditioning has advantageous effects during later stages of life due to epigenetic adaptation in chicken<ins>s [24, 25].</ins></p>



<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; In<ins> </ins>summary,&nbsp; it was concluded that the thermal conditioning of chicks during early age had <ins><del>a </del></ins><ins>a </ins>positive effect and improves the <ins>thermal</ins><ins> </ins>tolerance of the chicks in <ins>post-</ins>natal life as revealed by the reduced expression of <ins>the </ins>HSP<del>s</del> gene, temperature<ins><del>,</del></ins><ins>,</ins> and improved T<sub>3</sub> levels as stress indicators in native chickens and its cross varieties.</p>



<p><strong>References</strong><strong></strong></p>



<p>Al-Aqil, A. and Zulkifli, I. 2009. Changes in heat shock protein 70 expression and blood characteristics in transported broiler chickens as affected by housing and early age feed restriction. <em>Poult Sci.</em> <strong>88</strong>, 1358-1364.</p>



<p>Amrutkar, S.A. 2012. Evaluation of Frizzle, Naked neck and normal plumaged broilers under tropical stress conditions using functional genomics and epigenetic tools. Ph.D. thesis submitted to Deemed University, Indian Veterinary Research Institute, Izatnagar.</p>



<p>Benjamin Ivor J and D. Randy McMillan, 1998. Stress (Heat Shock) Proteins Molecular Chaperones in Cardiovascular Biology and Disease. <em>Circ Res.</em> <strong>83</strong>: 117 – 132.</p>



<p>Duangduen, C., Duangjinda, M., Katawatin, S. and Aengwanich, W. 2007. Effects of heat stress on growth performance and physiological response in Thai indigenous chickens (Chee) and broilers.&nbsp; <em>Kasetsart Veterinarians.</em> <strong>17</strong>, 122–133.</p>



<p>Etches, R.J., John, T.M. and Gibbins, A.M.V. 2008. Behavioural,&nbsp; physiological, neuroendocrine&nbsp; and&nbsp; molecular&nbsp; responses&nbsp; to&nbsp; heat&nbsp; stress,&nbsp; in&nbsp; Daghir,&nbsp; N.J.&nbsp; (ed.)&nbsp; Poultry Production in Hot Climate.&nbsp; Second edn. Wallingford, UK: <em>CAB international</em>, <strong>31</strong>-66.</p>



<p>Fotsa, J. and Mérat P Bordas. 2001. A Effect of the slow (K) or rapid (k+) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn x brown egg type cross. <em>Genetics Selection Evolution.</em> <strong>33</strong>, 659–670.</p>



<p>Guerreiro, E. N., P. F. Giachetto, P. E. N. Givisiez, J. A. Ferro, M. I. T. Ferro, J. E. Gabriel, R. L. Furlan and M. Macari, 2004. Brain and hepatic Hsp70 protein levels in heat-acclimated broiler chickens during heat stress.&nbsp;Rev. <em>Bras.&nbsp;Cienc.&nbsp;Avic.</em>&nbsp;<strong>6</strong>(4): 201 &#8211; 206.</p>



<p>Gunal, M. 2013. The effects of early age thermal manipulation and daily short term fasting on performance and body temperatures in broiler exposed to heat stress.&nbsp;<em>J Anim Physiol An.</em> &nbsp;<strong>97</strong>(5), 854-860.</p>



<p>Hartl, F.U. and Hayer-Hartl, M. 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. <em>Science</em>. <strong>295</strong>, 1852-1858.</p>



<p>Kingori, A.M., Wachira, A.M. and Tuitoek, J.K. 2010. Indigenous chicken production in kenya: a review. <em>International Journal of Poultry Science</em>.&nbsp;<strong>9</strong>, 309- 316.</p>



<p>Liang, H. M., D. Y. Lin, Y. D. Hsuuw, T. P. Huang, H. L. Chang, C. Y. Lin, H. H. Wu and K. H. Hung, 2016. Association of heat shock protein 70 gene polymorphisms with acute thermal tolerance, growth, and egg production traits of native chickens in Taiwan.&nbsp;<em>Archives Animal Breeding</em>,&nbsp;<strong>59</strong>(2): 173 &#8211; 181.</p>



<p>Ming, J., J. Xie, P. Xu, W. B. Liu, X. P. Ge, B. Liu, Y. J. He, Y. F. Cheng, Q. L. Zhou and L. K. Pan. 2010. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (<em>Megalobrama amblycephala Yih</em>). F<em>ish Shell fish Immunol, </em><strong>28</strong>: 407 &#8211; 418.</p>



<p>Piestun, Y., O. Halevy, D. Shinder, M. Ruzal, S. Druyan and S. Yahav, 2011. Thermal manipulations during broiler embryogenesis improves post hatch performance under hot conditions. <em>Therm. Biol.</em> <strong>36</strong>: 469 &#8211; 474.</p>



<p>Quinteiro-Filho, W. M., A. Ribeiro, V. Ferraz-de-Paula, M. L. Pinheiro, M. Sakai, L. P. M Sa, A. J. P. Ferreira and J. Palermo-Neto, 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. <em>Poult. Sci.</em> <strong>89</strong>(9): 1905 &#8211; 1914.</p>



<p>Rajkumar, U., A. Vinoth, M. Shanmugam, K. S. Rajaravindra, and S. V. Rama Rao, 2015. Effect of embryonic thermal exposure on heat shock proteins (Hsps) gene expression and serum T3 concentration in two broiler populations. <em>Anim. Biotechnol.</em> <strong>26</strong>(4): 260 &#8211; 267.</p>



<p>Sharifi, A.R., Horst, P. and Simianer, H. 2010. The effect of frizzle gene and dwarf gene on reproductive performance of broiler breeder dams under high and normal ambient temperatures. <em>Poultry Science.</em> <strong>89</strong>, 2356–2369.</p>



<p>Snedecor, G.W. and Cochran, W.G. 1989. Statistical Methods. 8<sup>th</sup> ed. IowaState University Press, Ames, Iowa.</p>



<p>Staib, J. L .,&nbsp;J. C. Quindry ,&nbsp;J. P. French ,&nbsp;D. S. Criswell and&nbsp;S. K. Powers, 2007. Increased temperature, not cardiac load, activates heat shock transcription factor 1 and heat shock protein 72 expression in the heart. <em>Am J Physiol Regul Integr Comp physiol.</em> <strong>292</strong>: 432 &#8211; 439.</p>



<p>Tamzil, M. H., R. R. Noor, P. S. Hardjosworo, W. Manalu and C. Sumantri, 2013. Acute heat stress responses of three lines of chickens with different heat shock protein (HSP)-70 genotypes.&nbsp;<em>Int. J. Poult. Sci.</em>&nbsp;<strong>12</strong>(5): 264 &#8211; 272.</p>



<p>Vinoth, A., Thirunalasundari, T., Shanmugam, M. and Rajkumar, U. 2016. Effect of early age thermal conditioning on expression of heat shock proteins in liver tissue and biochemical stress indicators in colored broiler chicken.&nbsp;<em>Eur J Exp Biol.</em>&nbsp;<strong>6</strong>(2), 53-63.</p>



<p>Vinoth. A .,&nbsp;T. Thirunalasundari ,&nbsp;J. A. Tharian , M.&nbsp; Shanmugam , U.&nbsp; Rajkumar, 2015. Effect of thermal manipulation during embryogenesis on liver heat shock protein expression in chronic heat stressed coloured broiler chickens. <em>J Therm Bio.</em> <strong>53</strong>: 162 &#8211; 171.</p>



<p>Wong, M.L. and Medrano, J.F. 2005. Real-time PCR for mRNA quantitation. <em>Biotechniques.</em>&nbsp;<strong>39</strong>(1), 75-88.</p>



<p>Yahav, S. 2009. Alleviating heat stress in domestic fowl &#8211; different strategies. <em>World Poult Sci J.</em>&nbsp; <strong>65</strong>, 719-732.</p>



<p>Yahav, S. and McMurtry, J.P. 2001. Thermotolerance Acquisition in Broiler Chickens by Temperature Conditioning Early in Life the Effect of Timing and Ambient Temperature.&nbsp;<em>Poult Sci. </em><strong>80</strong>(12), 1662-1666.</p>



<p>Zhang, W.W., Kong, L.N., Zhang, X.Q. and Luo, Q.B. 2014. Alteration of HSF3 and HSP70 mRNA expression in 490 the tissues of two chicken breeds during acute heat stress. <em>Genet Mol Res.</em> <strong>13</strong>, 9787-9794.</p>
]]></fullhtmlContent>
                        
                        <keywords language="eng">
                                                        
                                                            
                                <keyword>Abiotic stress</keyword>
                                                            
                                <keyword>acid-soluble</keyword>
                                                            
                                <keyword>Adaptability</keyword>
                                                            
                                <keyword>Aedes aegypti</keyword>
                                                            
                                <keyword>alcoholic beverages</keyword>
                                                            
                                <keyword>Alkalinity</keyword>
                                                            
                                <keyword>Allelopathy</keyword>
                                                            
                                <keyword>Anatomical</keyword>
                                                            
                                <keyword>Anatomy</keyword>
                                                            
                                <keyword>and diseases</keyword>
                                                            
                                <keyword>and sustainability</keyword>
                                                            
                                <keyword>Angiogenesis</keyword>
                                                            
                                <keyword>Anti-apoptosis</keyword>
                                                            
                                <keyword>Anti-fibrosis</keyword>
                                                            
                                <keyword>Antibiotics</keyword>
                                                            
                                <keyword>Apple</keyword>
                                                            
                                <keyword>Aquaculture</keyword>
                                                            
                                <keyword>Artificial insemination</keyword>
                                                            
                                <keyword>Asian Rust</keyword>
                                                            
                                <keyword>Asiatic Black Bear</keyword>
                                                            
                                <keyword>Atrazine</keyword>
                                                            
                                <keyword>AUPDC</keyword>
                                                            
                                <keyword>available nitrogen</keyword>
                                                            
                                <keyword>Average mean</keyword>
                                                            
                                <keyword>avoidable yield losses</keyword>
                                                            
                                <keyword>Backcross</keyword>
                                                            
                                <keyword>Bacterial Black Spot coefficient of multiple determinations R2</keyword>
                                                            
                                <keyword>Bacterial leaf blight</keyword>
                                                            
                                <keyword>Bio-regenerative tool</keyword>
                                                            
                                <keyword>Bioremediation</keyword>
                                                            
                                <keyword>Blast</keyword>
                                                            
                                <keyword>bollworm</keyword>
                                                            
                                <keyword>by-products</keyword>
                                                            
                                <keyword>cane yield</keyword>
                                                            
                                <keyword>capsicum</keyword>
                                                            
                                <keyword>Carrot</keyword>
                                                            
                                <keyword>climate change</keyword>
                                                            
                                <keyword>climate-resilient crop</keyword>
                                                            
                                <keyword>climate-smart agriculture</keyword>
                                                            
                                <keyword>clustering</keyword>
                                                            
                                <keyword>Coefficient of Variation</keyword>
                                                            
                                <keyword>Cognitive Proficiency</keyword>
                                                            
                                <keyword>Cold tolerance</keyword>
                                                            
                                <keyword>Colostrum composition</keyword>
                                                            
                                <keyword>Common bean</keyword>
                                                            
                                <keyword>Common beans</keyword>
                                                            
                                <keyword>common salt</keyword>
                                                            
                                <keyword>Conservation agriculture</keyword>
                                                            
                                <keyword>Constraints</keyword>
                                                            
                                <keyword>Contamination</keyword>
                                                            
                                <keyword>cooking qualities</keyword>
                                                            
                                <keyword>cooking quality</keyword>
                                                            
                                <keyword>correlation</keyword>
                                                            
                                <keyword>Cost of milk production</keyword>
                                                            
                                <keyword>Cow</keyword>
                                                            
                                <keyword>cropping systems</keyword>
                                                            
                                <keyword>crops</keyword>
                                                            
                                <keyword>CSI (Chlorophyll Stability Index)</keyword>
                                                            
                                <keyword>cultivar</keyword>
                                                            
                                <keyword>Curry leavespowder</keyword>
                                                            
                                <keyword>D-square</keyword>
                                                            
                                <keyword>dairy farmers</keyword>
                                                            
                                <keyword>Days open</keyword>
                                                            
                                <keyword>detoxification</keyword>
                                                            
                                <keyword>Dietary supplementation</keyword>
                                                            
                                <keyword>Diversity</keyword>
                                                            
                                <keyword>Dizygotic Twins.</keyword>
                                                            
                                <keyword>domestication syndrome</keyword>
                                                            
                                <keyword>Drip fertigation</keyword>
                                                            
                                <keyword>Economics</keyword>
                                                            
                                <keyword>Economics of Production</keyword>
                                                            
                                <keyword>Effect</keyword>
                                                            
                                <keyword>Environment</keyword>
                                                            
                                <keyword>eucalyptus oil</keyword>
                                                            
                                <keyword>exchangeable</keyword>
                                                            
                                <keyword>factor analysis</keyword>
                                                            
                                <keyword>Farmers Rights</keyword>
                                                            
                                <keyword>Fertigation schedule</keyword>
                                                            
                                <keyword>Fertilizer</keyword>
                                                            
                                <keyword>finger millet</keyword>
                                                            
                                <keyword>fish meal</keyword>
                                                            
                                <keyword>Foliar application</keyword>
                                                            
                                <keyword>food security</keyword>
                                                            
                                <keyword>FYM</keyword>
                                                            
                                <keyword>General Intelligence</keyword>
                                                            
                                <keyword>Genetic</keyword>
                                                            
                                <keyword>genetic variability</keyword>
                                                            
                                <keyword>Genetics</keyword>
                                                            
                                <keyword>genomics</keyword>
                                                            
                                <keyword>Genotype</keyword>
                                                            
                                <keyword>Genotype x environment interaction</keyword>
                                                            
                                <keyword>Germination Per cent</keyword>
                                                            
                                <keyword>germplasm registration</keyword>
                                                            
                                <keyword>Grain nutrient</keyword>
                                                            
                                <keyword>Groundnut</keyword>
                                                            
                                <keyword>Growth</keyword>
                                                            
                                <keyword>hard-to-cook trait</keyword>
                                                            
                                <keyword>Heat Shock Protein</keyword>
                                                            
                                <keyword>heavy metal</keyword>
                                                            
                                <keyword>herbicide</keyword>
                                                            
                                <keyword>Heritability</keyword>
                                                            
                                <keyword>heterosis</keyword>
                                                            
                                <keyword>hiiden hunger</keyword>
                                                            
                                <keyword>Histo-morphological</keyword>
                                                            
                                <keyword>Human health</keyword>
                                                            
                                <keyword>Humic acid</keyword>
                                                            
                                <keyword>inland salinity</keyword>
                                                            
                                <keyword>Irrigation</keyword>
                                                            
                                <keyword>Jejunum</keyword>
                                                            
                                <keyword>Kallakurichi</keyword>
                                                            
                                <keyword>Kidney</keyword>
                                                            
                                <keyword>Knol khol</keyword>
                                                            
                                <keyword>larvicidal potential</keyword>
                                                            
                                <keyword>leaf proline</keyword>
                                                            
                                <keyword>lignin</keyword>
                                                            
                                <keyword>Lignite based humin and Poultry manure based humin and Baby corn biomass production</keyword>
                                                            
                                <keyword>Liver</keyword>
                                                            
                                <keyword>LMH approach</keyword>
                                                            
                                <keyword>machine learning</keyword>
                                                            
                                <keyword>Macro</keyword>
                                                            
                                <keyword>macroelements</keyword>
                                                            
                                <keyword>Maize</keyword>
                                                            
                                <keyword>Makhana Production</keyword>
                                                            
                                <keyword>Mammary gland</keyword>
                                                            
                                <keyword>Mango</keyword>
                                                            
                                <keyword>manure</keyword>
                                                            
                                <keyword>Marker Assisted Breeding</keyword>
                                                            
                                <keyword>Marker-assisted selection</keyword>
                                                            
                                <keyword>Market</keyword>
                                                            
                                <keyword>Market demand</keyword>
                                                            
                                <keyword>Market potential</keyword>
                                                            
                                <keyword>marketing of milk</keyword>
                                                            
                                <keyword>Mastitis</keyword>
                                                            
                                <keyword>Membrane injury index</keyword>
                                                            
                                <keyword>Mesenchymal stem cells</keyword>
                                                            
                                <keyword>Micro</keyword>
                                                            
                                <keyword>microbial consortia</keyword>
                                                            
                                <keyword>microelements; seed germination</keyword>
                                                            
                                <keyword>milk production linear traits</keyword>
                                                            
                                <keyword>mineral</keyword>
                                                            
                                <keyword>Moisture stress/drought/limited irrigations</keyword>
                                                            
                                <keyword>Monozygotic Twins</keyword>
                                                            
                                <keyword>mosquito control</keyword>
                                                            
                                <keyword>MTU1010</keyword>
                                                            
                                <keyword>mulberry leaves</keyword>
                                                            
                                <keyword>Native chicken</keyword>
                                                            
                                <keyword>Natural service</keyword>
                                                            
                                <keyword>No poverty</keyword>
                                                            
                                <keyword>Non-verbal intelligence</keyword>
                                                            
                                <keyword>Number of millable canes and Fibre per cent.</keyword>
                                                            
                                <keyword>Nutrient Uptake</keyword>
                                                            
                                <keyword>Nutrient use efficiency</keyword>
                                                            
                                <keyword>nutritional value</keyword>
                                                            
                                <keyword>observation</keyword>
                                                            
                                <keyword>Okra</keyword>
                                                            
                                <keyword>organic complexed</keyword>
                                                            
                                <keyword>outbreak</keyword>
                                                            
                                <keyword>ovicidal potential</keyword>
                                                            
                                <keyword>Paenibacillus</keyword>
                                                            
                                <keyword>Paratanaisia</keyword>
                                                            
                                <keyword>Path analysis</keyword>
                                                            
                                <keyword>Pati duck</keyword>
                                                            
                                <keyword>PDI</keyword>
                                                            
                                <keyword>pearl millet</keyword>
                                                            
                                <keyword>Pelican</keyword>
                                                            
                                <keyword>Pendimethalin</keyword>
                                                            
                                <keyword>percent juice sucrose</keyword>
                                                            
                                <keyword>pests</keyword>
                                                            
                                <keyword>PGFRA</keyword>
                                                            
                                <keyword>phytochemical</keyword>
                                                            
                                <keyword>phytoremediation</keyword>
                                                            
                                <keyword>plant antioxidants</keyword>
                                                            
                                <keyword>Plant Secondary Metabolites</keyword>
                                                            
                                <keyword>planting density</keyword>
                                                            
                                <keyword>pod shattering</keyword>
                                                            
                                <keyword>pollution</keyword>
                                                            
                                <keyword>PPV&amp;FRA</keyword>
                                                            
                                <keyword>pre-emergence</keyword>
                                                            
                                <keyword>pre-weaned</keyword>
                                                            
                                <keyword>Precocious udder</keyword>
                                                            
                                <keyword>Price</keyword>
                                                            
                                <keyword>Priming; tomato; fruit morphology; biochemical components</keyword>
                                                            
                                <keyword>principal component analysis</keyword>
                                                            
                                <keyword>Principle component</keyword>
                                                            
                                <keyword>Protein contentTopramezone</keyword>
                                                            
                                <keyword>proteomics</keyword>
                                                            
                                <keyword>pupicidal efficacy</keyword>
                                                            
                                <keyword>Quality traits</keyword>
                                                            
                                <keyword>quizalofop</keyword>
                                                            
                                <keyword>RDF</keyword>
                                                            
                                <keyword>regression coefficient</keyword>
                                                            
                                <keyword>Residue burning</keyword>
                                                            
                                <keyword>Reverse Breeding</keyword>
                                                            
                                <keyword>rice</keyword>
                                                            
                                <keyword>RNAi</keyword>
                                                            
                                <keyword>root spread area</keyword>
                                                            
                                <keyword>Salinity tolerant rice cultures</keyword>
                                                            
                                <keyword>Salt stress</keyword>
                                                            
                                <keyword>seed vigour</keyword>
                                                            
                                <keyword>Seedling Vigour index-II</keyword>
                                                            
                                <keyword>senses</keyword>
                                                            
                                <keyword>Sensory evaluation</keyword>
                                                            
                                <keyword>Shukla&#039;s Stability Variance</keyword>
                                                            
                                <keyword>Skin</keyword>
                                                            
                                <keyword>Socio-economic</keyword>
                                                            
                                <keyword>Soil available primary</keyword>
                                                            
                                <keyword>soil microorganisms</keyword>
                                                            
                                <keyword>Soil organic carbon</keyword>
                                                            
                                <keyword>soil properties</keyword>
                                                            
                                <keyword>Soil secondary and micronutrients</keyword>
                                                            
                                <keyword>Soil test crop response</keyword>
                                                            
                                <keyword>Soybean</keyword>
                                                            
                                <keyword>SPAD/SCMR</keyword>
                                                            
                                <keyword>Spleen</keyword>
                                                            
                                <keyword>stable</keyword>
                                                            
                                <keyword>Studies</keyword>
                                                            
                                <keyword>sucking pests</keyword>
                                                            
                                <keyword>Superiority Measure</keyword>
                                                            
                                <keyword>Surface water</keyword>
                                                            
                                <keyword>sustainability</keyword>
                                                            
                                <keyword>Sustainable agriculture</keyword>
                                                            
                                <keyword>Tai Stability Analysis</keyword>
                                                            
                                <keyword>Tamil Nadu</keyword>
                                                            
                                <keyword>Temperatures</keyword>
                                                            
                                <keyword>Tetrameres</keyword>
                                                            
                                <keyword>Thermal conditioning</keyword>
                                                            
                                <keyword>TILLING</keyword>
                                                            
                                <keyword>Tomato</keyword>
                                                            
                                <keyword>transcriptomics</keyword>
                                                            
                                <keyword>Transgenic cotton</keyword>
                                                            
                                <keyword>Transition</keyword>
                                                            
                                <keyword>Triiodothyronine</keyword>
                                                            
                                <keyword>Urdbean</keyword>
                                                            
                                <keyword>Variability</keyword>
                                                            
                                <keyword>Velvet bean</keyword>
                                                            
                                <keyword>Verbal intelligence</keyword>
                                                            
                                <keyword>vermicompost</keyword>
                                                            
                                <keyword>vigour index</keyword>
                                                            
                                <keyword>VIGS</keyword>
                                                            
                                <keyword>water absorption</keyword>
                                                            
                                <keyword>Water soluble fertilizer</keyword>
                                                            
                                <keyword>Water Soluble Fertilizers</keyword>
                                                            
                                <keyword>Weed diversity</keyword>
                                                            
                                <keyword>weed management</keyword>
                                                            
                                <keyword>weeds</keyword>
                                                            
                                <keyword>WUE</keyword>
                                                            
                                <keyword>Yield</keyword>
                                                            
                                <keyword>yield character</keyword>
                                                            
                                <keyword>yield parameters</keyword>
                                                            
                                <keyword>Zebu cattle</keyword>
                                                            
                                <keyword>Zero hunger</keyword>
                                                            
                                <keyword>zero tillage</keyword>
                                                            
                                <keyword>Zinc</keyword>
                                                            
                                <keyword>Zinc fractions</keyword>
                                                            
                                <keyword>Zn-solubilizing bacteria</keyword>
                                                            
                                <keyword>zones</keyword>
                                                        
                        </keywords>
                                                                </item>
        </channel>
</rss>